Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045465 Similarity: 0.972 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA045465
Gene: GNPDA1
MFE: -35.869
ENS: 0.902
Length: 116.
Predicted Ligands:
methionine - 11/20
TPP - 5/20
glycine - 2/20
 RS: URS0000DB4792_1798282
MFE: -30.520
Ligand: TPP
Species: Gammaproteobacteria bacterium RIFCSPHIGHO2_12_FULL_41_15 TPP riboswitch (THI element)
 RS: URS0000C75A5E_1081102
MFE: -25.039
Ligand: TPP
Species: Sporothrix insectorum RCEF 264 TPP riboswitch (THI element)
 RS: URS0000BF38FD_1840095
MFE: -56.198
Ligand: methionine
Species: Streptomyces sp. F-3 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045465 URS0000DB4792_1798282 URS0000C75A5E_1081102 URS0000BF38FD_1840095
Length 116. 115. 116. 117.
Similarity - 0.972 0.971 0.971
Ensemble Norm 0.902 - - -
MFE -35.869 -30.520 -25.039 -56.198
Ligands - TPP TPP methionine
Gene GNPDA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 11. 7.002
Length SE - 1. 0. 1.
Lev Distance - 33. 34. 35.
UBS 10. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 0. 3. 2.
ILR 2. 3. 2. 2.
H 4. 3. 3. 3.
BL 3. 2. 2. 4.
BR 2. 2. 3. 4.
UN 0.103 0.130 0.086 0.060

Sequences

Field Description
UTR seq + 25 gcagucgcugcagccgccgcgggaggcguccgugaggaaacggcucagagagaacuuagguccuuugaccgagguccugcagguggacaagATGAAGCTCATCATCCTGGAGCACT
UTR dot + 25 ((((…)))).(((.((…)).)))(((((((((((..(((.((((((.((…….)))))))))))…)))).))..)))))……..((((………))))…
RS 1 seq UACAAACACUAGGGGUGUCAGGUAUAACCUGACUGAGAAAACAGAUAAUUAUUCUGUUUAACCCUCUGAACCUGAUCGGGUUAGGACCUGCGAAGGGAAGUGAGAAUCGCUUAUU
RS 1 dot …..(((((…)))))(((((.((((((((((.((((((((((…….)))))))…..))).)….).))))))))..)))))…….((((((…))))))…
RS 2 seq CGAACCAUCCAGUGGUGCUGCACAACGAGAACCGAAAACGAGGCGGUAUGGCUGAGAAUAUACGGCCUUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGACUGCUUCCCCC
RS 2 dot …(((((…)))))((((…..(.(((..(((….(((((.(((((……..))))).)))))…))).))).)…….))))….(((………..)))…
RS 3 seq GGUCAUGAGUGACAGUCAAGUGGCCCCGGCCGACUGUCCGGCAACCCUCCGUCCGUGGCGGGGUGCCCCGGGUGAGGACCGGGCCGCAGACAGCAAGGUCUGCGGCAAGCGCGGACC
RS 3 dot .((((….)))).(((..((((.(((((((.(((….((((.(((.((……)).))).))))…)))..)).))))))))).)))…..((((((((…..))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table