Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045472 Similarity: 0.982 Similarity: 0.980 Similarity: 0.977
UTR: 5HSAA045472
Gene: GNPDA1_0
MFE: -40.371
ENS: 0.905
Length: 94.
Predicted Ligands:
zmp-ztp - 5/20
glycine - 5/20
homocysteine - 3/20
 RS: URS0000D78E3C_36818
MFE: -41.861
Ligand: zmp-ztp
Species: Streptomyces subrutilus ZMP/ZTP riboswitch
 RS: URS000231A839_1262452
MFE: -46.164
Ligand: zmp-ztp
Species: Streptomyces sp. 769 ZMP/ZTP riboswitch
 RS: URS0000C13924_258533
MFE: -32.667
Ligand: glycine
Species: Mycobacterium cosmeticum Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045472 URS0000D78E3C_36818 URS000231A839_1262452 URS0000C13924_258533
Length 94. 94. 94. 95.
Similarity - 0.982 0.980 0.977
Ensemble Norm 0.905 - - -
MFE -40.371 -41.861 -46.164 -32.667
Ligands - zmp-ztp zmp-ztp glycine
Gene GNPDA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 6. 3.002
Length SE - 0. 0. 1.
Lev Distance - 23. 24. 28.
UBS 10. 11. 9. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 2.
ILR 2. 2. 2. 3.
H 2. 2. 2. 2.
BL 5. 5. 5. 4.
BR 4. 5. 5. 4.
UN 0.053 0. 0.032 0.011

Sequences

Field Description
UTR seq + 25 acgugacccgcgcggggccgggccgccggcgcagucgcugcagccgccgcgggaggcguccgugacaagATGAAGCTCATCATCCTGGAGCACT
UTR dot + 25 ((((..((((((.(.(((…((.(.((((…))))).)).))).)))))))..))))..((..((.(((((……))))).))..))…
RS 1 seq GCGGCGGGCCGUGACUGGCGUUCGGGUGGAUCACCACCGGGGAGCGGCCCGCGUACGUGCCGUACGCCGACUGCCGCGCGCCUGGGCGAACCGC
RS 1 dot ((((((((((((..((.(.((…((((…))))))).))..)))))))))…)))((.((.((((.(..((…..)).).)))).)).))
RS 2 seq GGUGCGCAGCCGCGACUGGCGUACGGGGAACGGACCCCGAGGGAGCGGUGCGCGGCCACACGCCUACGAGGUGCCGCCCGCCUGGGUACCCCGG
RS 2 dot ((((.(..((((((((((.(.(.(((((……))))).).)..)))).))))))..).))))..((.((((((………)))))).)).
RS 3 seq CCCGAUGCCUCUGGAAAGUGACGCGUUCCGCGCGUCCGCCCAUGGGGAAAGGUCUUCGGGCCGAAUCUCUCAGGCGCCCCGACAGAGGGAGAGGA
RS 3 dot (((((.((((((((…(.(((((((…))))))))..))).))))……).)))))((…((((((.(.((…)).).))))))..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table