Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045625 Similarity: 0.947 Similarity: 0.946 Similarity: 0.946
UTR: 5HSAA045625
Gene: GOLM1
MFE: -50.923
ENS: 0.871
Length: 190.
Predicted Ligands:
cobalamin - 14/20
lysine - 2/20
Mn2+ - 2/20
 RS: URS0002315047_1418104
MFE: -43.099
Ligand: cobalamin
Species: Clostridium argentinense CDC 2741 Cobalamin riboswitch
 RS: URS0002323E07_420246
MFE: -66.261
Ligand: cobalamin
Species: Geobacillus thermodenitrificans NG80-2 Cobalamin riboswitch
 RS: URS0002311EAD_1211035
MFE: -28.055
Ligand: cobalamin
Species: Lysinibacillus massiliensis 4400831 = CIP 108448 = CCUG 49529 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045625 URS0002315047_1418104 URS0002323E07_420246 URS0002311EAD_1211035
Length 190. 190. 192. 190.
Similarity - 0.947 0.946 0.946
Ensemble Norm 0.871 - - -
MFE -50.923 -43.099 -66.261 -28.055
Ligands - cobalamin cobalamin cobalamin
Gene GOLM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.020 15.002 12.002
Length SE - 0. 4. 0.
Lev Distance - 65. 59. 67.
UBS 12. 11. 12. 13.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 4.
ILR 0. 3. 3. 3.
H 4. 4. 4. 5.
BL 3. 3. 4. 3.
BR 4. 4. 3. 3.
UN 0.132 0.274 0.172 0.174

Sequences

Field Description
UTR seq + 25 cacccgaaggcguccgggaaucuucacuuuuuccguugcuagcaguggaagggucacagaccaaacacuaaggccugagcggugacaaccgaggcgagaugauggucaacagggaaugccucgugggagaaaaaagacaauuuuauucucagcgcugauuuugagATGATGGGCTTGGGAAACGGGCGTC
UTR dot + 25 ..((((……..))))………(((((((((((….)))))))))))…..(((((..((((…((((…((((….)))))))).)).)).)))))……..(((((.(((…………………(((((((.(((.(((…….))).)))))))))))))))))).
RS 1 seq UUGAAUAAUAAAGAAAUAGGUUUAGUGCAGAUAAUUAUCUGUAUUAAUUAAAAGGGAAGUUGGGUGAAAAUCCCACACGGUCCCGCCGCUGUAAGAGUGUAGUCUUUUCAAAUAAACCACUGGGAAACUGGGAAGGUAGAAAAGAUGAUAAUACUUGAGUCAGAAGACCUGCCUAUUUUUUCGCCGGAAC
RS 1 dot …………………(((((((((((….)))))))))))……((((.((((((…….)))).))..))))..((((…..))))………………..((((((((.((((.((((……(((..(((…))).)))…..)))).))))…)))).))))…
RS 2 seq UGGCGGUAAGACAAACAAGGUGCCUAGCCCGCUUAGGGCUUGGGUGAAAAGGGAAGCUCGGUGAAAAUCCGGCACGGUGCCCGCCACUGUGAUGGGGAGCUUUGCGGCAACAAGUCACUGAAGGAUGCUUCGGGAAGACGCCGCCAAGCGAUGAUCCUAAGUCAGGAGACCUGCCUUGUUUGGAUCGGACGG
RS 2 dot …………………(((((((((…..))))).))))…….(((((((……..((((.(((((((…..))))))).)))))))))))(((((…..(((.((((((….))))))…))))))))….((.((((((((((.((((…)))).))))…))))))..)).
RS 3 seq AUAUUCCAAAAUUAAGUAAGUGCUCAUGUAGAAUCUUAAAUGAGUUAAAAGGGAAAUUAGUGAAAAUCUAAUGCAGCCCCCGCUACUGUAAUAGCAGAUGAAAUCACAAAAAAUCACUGUCUAAGGAUGGGAAGAUGUGAAAGUAAAAUGAAGCUUGAGCCAGGAUACCUGCUUACUUAAUAGUUACUUG
RS 3 dot …………………((((((.(((….))).))))))…..(((..(((((…….)))))….)))(.((((……)))).)……(((((…..(((((……)).)))…..)))))((((((….(((..((((.((((…)))))))))))…..)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table