Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA045718 Similarity: 0.988 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA045718
Gene: GOSR1
MFE: -8.198
ENS: 0.985
Length: 51.
Predicted Ligands:
glutamine - 18/20
unknown - 2/20

 RS: URS0000C64332_12908
MFE: -8.882
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C80478_12908
MFE: -9.662
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000E5FDBA_1094558
MFE: -14.898
Ligand: unknown
Species: Bartonella tamiae Th239 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA045718 URS0000C64332_12908 URS0000C80478_12908 URS0000E5FDBA_1094558
Length 51. 51. 51. 52.
Similarity - 0.988 0.988 0.988
Ensemble Norm 0.985 - - -
MFE -8.198 -8.882 -9.662 -14.898
Ligands - glutamine glutamine unknown
Gene GOSR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.025 2.025 0.002
Length SE - 0. 0. 1.
Lev Distance - 15. 15. 15.
UBS 3. 2. 2. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 2. 2. 3.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.255 0.412 0.412 0.212

Sequences

Field Description
UTR seq + 25 aucccggcugacguuggacgacaaagATGTTTGAGACAATGGCGATTGAGA
UTR dot + 25 …(((((….)))))….((((….))))…((((….))))…
RS 1 seq GACGUUCAUCCAACAGGACGGAAGUAGACUACUCAGUCGAAGGAACGCAUU
RS 1 dot ..(((((……..)))))……((((….))))………….
RS 2 seq CACGUUCAUCCUAAGGGACGGAAGUAGGCUGAAAAGCUGAAGGAACGCACC
RS 2 dot ..(((((……..)))))……((((….))))………….
RS 3 seq AUCGGACCUGUGUUACAGGUGGCUCCACCGGGCGCCUAUCCCUCGGCAACUA
RS 3 dot …..((((((…)))))).((((….))))(((……..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table