Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA046015 Similarity: 0.991 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA046015
Gene: GPN1
MFE: -11.537
ENS: 0.755
Length: 54.
Predicted Ligands:
unknown - 16/20
TPP - 1/20
homocysteine - 1/20
RS: URS0000E605F8_1797572
MFE: -20.270
Ligand: unknown
Species: Burkholderiales bacterium RIFOXYC12_FULL_65_23 nhaA-I RNA
RS: URS0000D4ACC6_1336806
MFE: -12.742
Ligand: TPP
Species: Reinekea forsetii TPP riboswitch
RS: URS0000E60855_1294143
MFE: -18.729
Ligand: unknown
Species: Pseudomonas denitrificans ATCC 13867 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA046015 URS0000E605F8_1797572 URS0000D4ACC6_1336806 URS0000E60855_1294143
Length 54. 54. 54. 55.
Similarity - 0.991 0.990 0.989
Ensemble Norm 0.755 - - -
MFE -11.537 -20.270 -12.742 -18.729
Ligands - unknown TPP unknown
Gene GPN1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.028 3. 7.013
Length SE - 0. 0. 1.
Lev Distance - 12. 12. 11.
UBS 4. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 3.
ILR 1. 1. 1. 2.
H 1. 1. 1. 1.
BL 1. 1. 0. 0.
BR 1. 0. 1. 0.
UN 0.333 0.167 0.333 0.218

Sequences

Field Description
UTR seq + 25 agggaagaggauuuggaggguaccggcgcATGAAACAATATGGACTTGGACCCA
UTR dot + 25 ……………..((((.((((..((((……))))..)).)))))).
RS 1 seq GGGUGUCGGUGGCAUUGGGUCUCGGCAGGUUUUUGCGCAGGUCGGGCCGCCGCG
RS 1 dot ……..(((((….((((.((((..((……))..))))))))))))).
RS 2 seq GCUGAGAAAAACCCGUUGAACCUGAACCAGUUUGUACUGGCGUAGGGAGCAAAG
RS 2 dot …………..(((…((((..(((((….)))))..)))).)))….
RS 3 seq GGGUGUCUGCUGCAAGGGUGGCGAGACAGGUCAAUGCGCAGGUCGGGCCGCCGCG
RS 3 dot ………..((…((((((..(((..((……))..)))..)))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table