Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA046225 Similarity: 0.969 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA046225
Gene: GPR149
MFE: -22.250
ENS: 0.841
Length: 125.
Predicted Ligands:
TPP - 9/20
FMN - 3/20
SAM - 3/20
 RS: URS0000ABA7FE_324602
MFE: -40.976
Ligand: FMN
Species: Chloroflexus aurantiacus J-10-fl FMN riboswitch (RFN element)
 RS: URS0000C6D3E4_1653480
MFE: -52.861
Ligand: cobalamin
Species: Alloactinosynnema sp. L-07 Cobalamin riboswitch
 RS: URS0000C7A122_1284680
MFE: -35.935
Ligand: FMN
Species: Actinomyces sp. S6-Spd3 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA046225 URS0000ABA7FE_324602 URS0000C6D3E4_1653480 URS0000C7A122_1284680
Length 125. 125. 124. 125.
Similarity - 0.969 0.968 0.966
Ensemble Norm 0.841 - - -
MFE -22.250 -40.976 -52.861 -35.935
Ligands - FMN cobalamin FMN
Gene GPR149 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 3.001 7.002
Length SE - 0. 1. 0.
Lev Distance - 37. 41. 43.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 1. 2. 1. 2.
H 3. 4. 3. 4.
BL 3. 2. 2. 2.
BR 4. 1. 4. 2.
UN 0.112 0.144 0.137 0.152

Sequences

Field Description
UTR seq + 25 cuugguaggaggaaugaaaucugauuugcagcagccggucuuucuuuugagaaaauuaucagacucauugauaagggaaauuaaauauugaccaaggacaATGTCTTTATTTCTCAGTAACTTAT
UTR dot + 25 (((((.(((((((.((….(((…..)))….)).))))))).)))))….(((((((…..)))))))(((((((.((((((((……..)))))).)).)))))))……….
RS 1 seq AACGAUCUUCGGGGCAGGGUGAAAUUCCCGAUCGGUGGUAUAGCCCACGAGCGUGUUGAGAGGCACGCAGGAUCCGGUGUAACUCCGGGGCCGACGGUUACAGUCCGGAUGUAAAGAAGAUCCAG
RS 1 dot ..(((…((((((………..)))))))))((((……))))..(((((((….))))))).(.(((((((((((((.((….))..)))))))..)))))).)………….
RS 2 seq GAGGAAACCGGUGCGAUUCCGGUGCGGUCCCGCCACUGUGACCGGGGAGCGCCACUCCCCCGCGUGCCACCGGGGCGACCUGGGAAGGCCGGAGCGGCGCGUCGAUCCGGGAGCCAGGACACUC
RS 2 dot ………(((((..((((((((((((……))))).))))))).)))))..(((((((.((…))))))).))(((((…..(((((.((……)).)))))…)))))……
RS 3 seq CGUGUACUUCGGGGUCGGUGUAAGUCCGAGCCGGCGGUGAUAGUCCGCGACCCGCAAUACCUAUUGCGGUUGAACUGGUGAAACUCCAGUACCGACAGUUAAAGCCUGGAUGGGAGAAGUAGUUG
RS 3 dot ((((.((((((..((((((……….))))))..))).))).))))..(((((((….)))))))….(((((…….))))).(((.(((…….)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table