Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA046654 Similarity: 0.954 Similarity: 0.950 Similarity: 0.949
UTR: 5HSAA046654
Gene: GRHL1
MFE: -60.447
ENS: 0.901
Length: 166.
Predicted Ligands:
cobalamin - 8/20
Mg2+ - 5/20
SAM - 4/20
 RS: URS0000C49B4B_1703354
MFE: -42.687
Ligand: FMN
Species: Coxiella sp. DG_40 FMN riboswitch (RFN element)
 RS: URS0000C898A2_1702221
MFE: -47.363
Ligand: lysine
Species: Faecalibaculum rodentium Lysine riboswitch
 RS: URS000231D18D_1805201
MFE: -63.306
Ligand: cobalamin
Species: Gemmatimonadetes bacterium 13_2_20CM_1_70_33 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA046654 URS0000C49B4B_1703354 URS0000C898A2_1702221 URS000231D18D_1805201
Length 166. 167. 167. 166.
Similarity - 0.954 0.950 0.949
Ensemble Norm 0.901 - - -
MFE -60.447 -42.687 -47.363 -63.306
Ligands - FMN lysine cobalamin
Gene GRHL1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 20. 10.001 12.
Length SE - 1. 1. 0.
Lev Distance - 52. 62. 63.
UBS 11. 10. 11. 10.
BS 0. 0. 0. 1.
ILL 5. 3. 3. 6.
ILR 6. 3. 4. 3.
H 2. 3. 2. 2.
BL 2. 4. 3. 2.
BR 1. 2. 2. 1.
UN 0.157 0.174 0.120 0.169

Sequences

Field Description
UTR seq + 25 agagcgagaaaagcaaacccaacccgucggggccgccgcuccggacccgcagccgccgccgccgccuccuccccccggaucggguguacugucccaacccgaaaguccaguucugcggcccggcagcggcgagcgggcgcgATGACACAGGAGTACGACAACAAAC
UTR dot + 25 .(((((……((…(((……..)))…)))))))((..(((((.(((((.((((((((…((……(((((((((………..))))))…)))))….)))))..))).)))))..)))))..))…………………….
RS 1 seq ACCUAUCUUCAGGGCGGGGUGAGAGUCCCUACCGGCGGUAGUUUUAUCAAUUCGGUUUUGGAUUUAUAAAAGAGCCCGCGAGCGCUUCAUAUGAUCAUAUAUGAAGGUCAGCAGAUAUGGUCAAAAUCCAUAGCCGACGGUUAGAGUCCGGAUGAAAGAAGAAGAUA
RS 1 dot ..(((((.((.((..((((……))))..)))).)))))……….((((((.(((((((…………((..((.(((((((((….)))))))))))..))………..))))))).))))))(((…….)))……………..
RS 2 seq GAUGAAGAUAAAGGCAGCGGUGCAGAUGAGUACUUUCGGGAGCCGGCAGGCUGGGAACGAAAGGAAAGGCAAUCAUCGCCGAACGGGCGCGCCGGCGGGCGUGAAUCGUGGGAUGUCAGGGAAGACCUGCCAGACUCCUUCAGGUAUGAAGAGGCGUUAUCACAUAA
RS 2 dot ………….(((….))).(((((((((((..((((((.((((((((((……………….((((.((..((((.((((((….))))))..))))))))))))))……)))))).).)))))..))))))………)))))……
RS 3 seq CCAGUUACAAAGCGAACGGGGAAUCACGGAAGCCGGUGCGAAUCCGGCGCGGCCCCGCCACUGUAACGGGCACGAUCGUAACGGCUCACGGCCACUGGGGGUGUUCACCCGGGAAGGCGAGCCGAUCGCCCGAAGCCAGGAGACCUCUCCGUUCGCGCCACCUGUC
RS 3 dot ………..(((((((((((….(((..(((.((((…….))))))).)))(..(((…(((((..((((…..(((((…(((.(((((……..)))))…)))))))))))))))))….)))..)…)))))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table