Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA046732 Similarity: 0.954 Similarity: 0.951 Similarity: 0.950
UTR: 5HSAA046732
Gene: GRIK2
MFE: -34.322
ENS: 0.799
Length: 175.
Predicted Ligands:
cobalamin - 11/20
lysine - 7/20
guanidine - 1/20
 RS: URS0000BEED5F_745411
MFE: -63.720
Ligand: lysine
Species: Gallaecimonas sp. 3-C-1 Lysine riboswitch
 RS: URS0000ABA0A9_641146
MFE: -62.
Ligand: lysine
Species: Scardovia inopinata F0304 Lysine riboswitch
 RS: URS0000C7EEB0_1263021
MFE: -54.311
Ligand: lysine
Species: Firmicutes bacterium CAG:41 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA046732 URS0000BEED5F_745411 URS0000ABA0A9_641146 URS0000C7EEB0_1263021
Length 175. 174. 176. 174.
Similarity - 0.954 0.951 0.950
Ensemble Norm 0.799 - - -
MFE -34.322 -63.720 -62. -54.311
Ligands - lysine lysine lysine
Gene GRIK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.001 30. 25.002
Length SE - 1. 1. 1.
Lev Distance - 55. 51. 54.
UBS 10. 10. 14. 12.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 4.
ILR 5. 2. 3. 3.
H 4. 4. 5. 4.
BL 5. 4. 5. 3.
BR 1. 2. 4. 3.
UN 0.120 0.155 0.102 0.080

Sequences

Field Description
UTR seq + 25 agcaauuggcaaauccagaauguuaaacccggucuagcuccaaauaaauguuauauauaaggguagagaguaaagaagaauaccacuguucuucuccacauacacagaaggaaucuaggugguauuuuugaauauguggaaucuggcccaATGAAGATTATTTTCCCGATTCTAA
UTR dot + 25 ((((.((((…..))))..))))..((((.((.((((………..))))…))..))))………..((((((((((((.(((((((……….)))))))…..))))))))))))…….(((((((.((…(((((…)))))..)).))))))).
RS 1 seq GCGCCAAGUAGAGGUGCGUCCUGGAUGAGUCGCCGGGGGGAAGGUGAUGCUGUGGAUCCCCGGUAAAAGGCCAGUGCGCCGAAGUGAAGCCGACAUCAAGCGGUUUUGCUGGUGUCGUGGGCGAAAGUCGCGGCACUGCCAUAGUCCUAAACACUAUGGAGCGCUACCGAAGGC
RS 1 dot (((((…….)))))…………..((((((((……………..))))))))….(.(((..(((((..((((((((((……..)))))))))))))))..))).)…..(((.(((.((.(((((((…….))))))))).)))..)))….
RS 2 seq AGUAAUCGAAGAGGUGCGACUGACAUCAGUAGCCAUCAUGAGCCGGCCAGGCUAUGACUGAUGGUAAAAGGGGAAGCCGCCGAAGCCCCGGGCAGGUACAAGCCCGGGAGCUGGUCUGCUGCUGAAUAAGUUUCAGACUGUCGCGAAAUCAGAUUCGCGGAGCGCUGUCGAAACUC
RS 2 dot .((.(((…..))))).((((….)))).(((((((..((((…..))))…..)))))))………(((.((.((((((((((((……..))))))).)))..)).)).)))…..((((((.(((.((((((((……))))))….)).))))))))).
RS 3 seq AAGCAAGGUAGAGGUGCGCUUGUGUAUUAGUAUGUAUACGGAGAUAUGCAAUUAUCUUUGAUGUAUACGGAAAGGACACAGUGCCGAAGUUUGAAUAUUAUUGCGAAUAUUCAUUCUGGGCAUAUCGUUAACAGCGGUAUGACUGUCAUCGUAAGGUGGGGAGCUAUCGCUGUU
RS 3 dot ..((((((((….))).)))))……((((((((.((((((((……))))))))))))))))……(((…(((((..((..((((((((……))))))))..)).)))))…)))((((((((((.(..(.(((((….))))).)..)))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table