Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA046799 Similarity: 0.953 Similarity: 0.952 Similarity: 0.950
UTR: 5HSAA046799
Gene: GRK5
MFE: -28.875
ENS: 0.887
Length: 166.
Predicted Ligands:
glucosamine - 8/20
cobalamin - 5/20
FMN - 3/20
 RS: URS0002320E67_2754
MFE: -41.
Ligand: cobalamin
Species: Synergistes jonesii Cobalamin riboswitch
 RS: URS0000ABC5B9_485913
MFE: -60.093
Ligand: glucosamine
Species: Ktedonobacter racemifer DSM 44963 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB35D1_491952
MFE: -50.403
Ligand: FMN
Species: Marinomonas posidonica IVIA-Po-181 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA046799 URS0002320E67_2754 URS0000ABC5B9_485913 URS0000AB35D1_491952
Length 166. 164. 166. 167.
Similarity - 0.953 0.952 0.950
Ensemble Norm 0.887 - - -
MFE -28.875 -41. -60.093 -50.403
Ligands - cobalamin glucosamine FMN
Gene GRK5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.014 10.004 8.
Length SE - 4. 0. 1.
Lev Distance - 57. 60. 62.
UBS 9. 9. 10. 11.
BS 0. 1. 0. 0.
ILL 3. 3. 2. 4.
ILR 3. 3. 1. 4.
H 3. 3. 5. 4.
BL 3. 3. 3. 3.
BR 3. 2. 3. 2.
UN 0.048 0.165 0.114 0.066

Sequences

Field Description
UTR seq + 25 guauaaucaguguauaccuaggugcugguaccaucugcguuuuauagaaggguuaagcaaauugucuacgaucacacagcuuacaaggcagaauaugaaguuacuccagaugaaaaacugggagagaaagggaaggaaauuATGGAGCTGGAAAACATCGTGGCCA
UTR dot + 25 (((((…….)))))…..((((.(..((.((((…….)))).))..).))))…((.(((((((….((((((………………….(((((……..)))))………………….))))))……))))))).))
RS 1 seq AUAAAUAAAAAUAUUGCUGCAGAAAACGGGAAUCGGGUGAAAAUCCUGAACGGCCCCGCCACUGUAAGCCGCGACGAGAUCGCAUUAUGCCACUGGAAUUUUCGGGAAGGCGCGAUGGAGGAUGAACGGCAAGCCAGGAUACCAUUCUGCACAAAGUUGCGGCA
RS 1 dot ……………..(((((….((((..(((((…….)))))…..))))…))))).((((((((…(((((…..(((.((.((….)).))..))))))))(.((((((………………)))))).)…..)))))))).
RS 2 seq CUGGAUUGAGUAGCGCAUGGACCAGGCUUGAGGAGGAGGCCUGGUUGACGAGGAGGAGGCUGUUCGGAGCAUCAGCGGGGAGCCUCCAGGGCCGAUCACAGCCCUGAGAAGUGGGUCGACAAAACCAGGUGGUAACGCCGGGGACAAUAUACUCACAGUGAGCAAG
RS 2 dot (((…….)))((..(.((((((((((…….)))))))))).)))…..((((((.((((………)))).))))))((((((……..))))))….((((((……..((.((((….)))).))……..))))))……….
RS 3 seq AUCGAACUUCGGGGCGGGGCGAAAUUCCCCACCGGCGGUGACUUUGAAAGUGAUGAGCUUUCAAACAGCCCGCGAGCGCUUGAAACCCUAUUAAUGGGCUUUUAAGGUCAGCAGAUCUGGUGUGAUUCCAGAGCCGACGGUUACAGUCCGGAUGAUAGAAGAUCGAC
RS 3 dot ..(((…))).((.((((…….)))).)).((((….(((((((((…..)))))))))….))))……((((….((((((.((((((……(((.((…(((((…….))))))).)))……))))))..))))))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table