Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047016 Similarity: 0.975 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA047016
Gene: GSS
MFE: -41.741
ENS: 0.962
Length: 112.
Predicted Ligands:
SAM - 12/20
glycine - 5/20
Ni/Co - 1/20
 RS: URS0000C33962_1321778
MFE: -29.738
Ligand: SAM
Species: Clostridiales bacterium oral taxon 876 str. F0540 SAM riboswitch (S box leader)
 RS: URS0000C0CBE0_1703387
MFE: -39.005
Ligand: SAM
Species: Anaerolineae bacterium SM23_ 63 SAM riboswitch (S box leader)
 RS: URS0000C19DD7_1472719
MFE: -34.579
Ligand: glycine
Species: Paenibacillus sp. P1XP2 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047016 URS0000C33962_1321778 URS0000C0CBE0_1703387 URS0000C19DD7_1472719
Length 112. 112. 112. 112.
Similarity - 0.975 0.974 0.973
Ensemble Norm 0.962 - - -
MFE -41.741 -29.738 -39.005 -34.579
Ligands - SAM SAM glycine
Gene GSS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.005 8. 4.010
Length SE - 0. 0. 0.
Lev Distance - 31. 32. 35.
UBS 6. 6. 8. 6.
BS 3. 1. 2. 2.
ILL 1. 0. 0. 2.
ILR 2. 1. 1. 2.
H 3. 3. 3. 2.
BL 3. 2. 3. 3.
BR 2. 1. 3. 1.
UN 0.062 0.134 0.054 0.161

Sequences

Field Description
UTR seq + 25 aucgaggccccgcccccugagccuggguagcggcgcgagggccgggagaaccguucgcggaggaaaggcgaacuaguagguguugggATGGCCACCAACTGGGGGAGCCTCT
UTR dot + 25 …(((((.((.(((((((.((((..((……))..))))))))…(((((((((………))))))…..)))(((((……..))))).))))).))))).
RS 1 seq UCCUUAUCUAGAGAAGCCGAGGGACUGGCCUUAUGACGCUUCAGCAACCAGCAUAUUUCAUUUGUAUGUAUGGUGCUAAAUCCUGCAGACAUUAUAGUCUGAAAGAUGAGGG
RS 1 dot .((((((((…(((((.((((……))))…..)))))(((.((((((((((…….)))))).)))))))……..(((((……)))))..)))))))).
RS 2 seq CUCUUAUCCAGAGAGGUGGAGGGACCGGCCCUGCGAAGCCUCGGCAACCUACCUGCUUAUUGAUAGCGGUGUGGUGCGAAUUCCGACAGACGGAGUGUCUGGAAGAUGAGAG
RS 2 dot ((((((((((((((((((.((((…..)))).)…))))).((.(((.(((((((…….))))).)))))))..((((((…..)))))).))))))…))))))
RS 3 seq UGAUGGCGAACGGGAGAGACUGCCUUUUUCAUAAGGCGGCACCGAAGGAGCAAGCUGCGGGAGGGCACAAACCGGCGGCUAAUCUCUCAGGUACAAGGAACCGUCGCCGGAC
RS 3 dot …(((((.((((….(.(((((((……))))))))(((…((((..((((((.((……….)).))))))…))))..)))……..)))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table