Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047081-1 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA047081-1
Gene: GSTM1
MFE: -24.258
ENS: 0.740
Length: 79.
Predicted Ligands:
SAM - 16/20
cobalamin - 2/20
Ni/Co - 1/20
 RS: URS0000DA4C4F_1280950
MFE: -24.985
Ligand: SAM
Species: Hyphomonas johnsonii MHS-2 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000D932FC_1217970
MFE: -19.126
Ligand: Ni/Co
Species: Oceanicola litoreus SAM riboswitch (alpha-proteobacteria)
 RS: URS000231804A_309807
MFE: -29.873
Ligand: cobalamin
Species: Salinibacter ruber DSM 13855 AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047081-1 URS0000DA4C4F_1280950 URS0000D932FC_1217970 URS000231804A_309807
Length 79. 78. 80. 77.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.740 - - -
MFE -24.258 -24.985 -19.126 -29.873
Ligands - SAM Ni/Co cobalamin
Gene GSTM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.006 7.001 2.
Length SE - 1. 1. 4.
Lev Distance - 21. 20. 19.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 2. 2. 1. 3.
H 2. 1. 2. 2.
BL 1. 1. 3. 1.
BR 1. 2. 2. 1.
UN 0.063 0.141 0.087 0.078

Sequences

Field Description
UTR seq + 25 ugcggaauccgcaccaaccagcaccaugcccaugauacugggguacugggacauATGCCCATGATACTGGGGTACTGGG
UTR dot + 25 (((((…)))))….((((…..(((((..(((.(..(((((……….)))))..))).)..))))))))).
RS 1 seq UCUCCCUUUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUUAAACAAGUCGCUAAAAGGCCGCGCGGACCCGCCA
RS 1 dot ………..(((((….(((((..((((((..(((.((………)).)))…))))))..))).)))))))
RS 2 seq AGCGGCACAAGUGGCGAUUUGUUCACCGGAUUGCGGGCCACUCUAAACACUUCCGCUAAAGAGGUCAGGCAGAGGGAGCC
RS 2 dot .((.((….)).))…..((((.((…((((.((((..(((……………)))))))..)))).)))))).
RS 3 seq CUCCUGCGUCACGGGGAAAGUCCGGUGGAAGGCCGGCGCUGCCGCGCAACGGUUCCAGCCCGAAUGCCCGCUCGGAG
RS 3 dot .(((((…..)))))….((((((((..(..(((.(((((((…..)))…)))))))..)..)))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table