Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047212 Similarity: 0.958 Similarity: 0.956 Similarity: 0.955
UTR: 5HSAA047212
Gene: GTF2E2
MFE: -42.901
ENS: 0.786
Length: 166.
Predicted Ligands:
Mg2+ - 14/20
cobalamin - 5/20
SAM - 1/20
 RS: URS0000C7F3EF_1734396
MFE: -40.036
Ligand: Mg2+
Species: Desulfosporosinus sp. BRH_c37 M-box riboswitch (ykoK leader)
 RS: URS0000D8D69B_1665556
MFE: -45.350
Ligand: SAM
Species: Bacillus sp. LL01 SAM riboswitch (S box leader)
 RS: URS0000AB471E_388400
MFE: -36.840
Ligand: Mg2+
Species: Bacillus sp. B14905 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047212 URS0000C7F3EF_1734396 URS0000D8D69B_1665556 URS0000AB471E_388400
Length 166. 166. 166. 165.
Similarity - 0.958 0.956 0.955
Ensemble Norm 0.786 - - -
MFE -42.901 -40.036 -45.350 -36.840
Ligands - Mg2+ SAM Mg2+
Gene GTF2E2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 15.002 17.
Length SE - 0. 0. 1.
Lev Distance - 51. 53. 53.
UBS 8. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 5.
ILR 3. 5. 4. 3.
H 1. 2. 1. 1.
BL 2. 4. 4. 2.
BR 3. 2. 3. 6.
UN 0.042 0.048 0. 0.061

Sequences

Field Description
UTR seq + 25 gucaggagguuugguuccuggcccuggcucuuccaucugugcgaccuuaaccagacagcuucacuucagauuucacguauuaaaauaggaauaacacuaauaccuguuugcuccuagaguugcgagggucaaauacucauuATGGATCCAAGCCTGTTGAGAGAAA
UTR dot + 25 .((((.((((((((.((((((((((…………..((((((((….(((((((………..(((((………….)))))………..)))))))…..)).)))))))))))))…………))).)))))))).))))……
RS 1 seq AUUUAUCUCUGUUAGGUGAGGCUCCUGCAUAAACAUAGGCCACUGCCCAGAAAUGUCGAGAGACGCCAAUUGGGUAGAACAGGUAUUACCGGCAUAAGGUUUUACAUAAGGUGGCUGAGAUAACUCUACGCUAUGCAGUGCUAAAGCUCAACGAGUAGGGAGGUCC
RS 1 dot ..(((((((.((((.((((((((..(((…………..((((((((…((((….))))….))))))))…………..)))…))))))))……)))).)))))))((((((.(..((.(((……)))))..).))))))……
RS 2 seq CUCUUAUUCCGAGCUGGUGGAGGGACAGGCCCUAUGAAACCCAGCAACCUGCUCAAAGGAUGAGCGAGCGCAAAAAGCACGCCGCUUUUUUUAUUUUUAGACCAGAUAUGGUCGCUUGAGAAAAGGUGCUAAACCUGAGCAAGGCUCUGACCUUGACCGAUAAGAG
RS 2 dot ((((((((…….(((.((((..((((((………..((((.(((.(((((..((((((((.(((………))))))))…………………..)))..)))))…)))))))…………))).))).)))).)))))))))))
RS 3 seq GACUCCCUUCGUUAGGUGAGGCUCCUAUGUGGAGAUACGCUACUACCCAAAAAUGUCGAGAGACGCCAAUGGGUCAACAGAAAUCAUCGAAAUAAGGUGUUUUUUAACGUAGCUGGAUAAUUUCCUAUGCCGCAUAGUGCUAAAACUCAACGUUUGAAGGUAACA
RS 3 dot …..((((((..(.(((((((..((((((((..(((………(((…((((.((((((((((……………………….)))))))))).))))…)))………))).)))))))).))…..)))).).).))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table