Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047312 Similarity: 0.989 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA047312
Gene: GTF3C1
MFE: -18.821
ENS: 0.671
Length: 57.
Predicted Ligands:
unknown - 13/20
glutamine - 7/20

 RS: URS0000E5FB36_465721
MFE: -27.757
Ligand: unknown
Species: Steroidobacter denitrificans nhaA-I RNA
 RS: URS0000E6033C_1735674
MFE: -24.307
Ligand: unknown
Species: Sphingomonas sp. Leaf9 nhaA-I RNA
 RS: URS0000D69519_12908
MFE: -15.257
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047312 URS0000E5FB36_465721 URS0000E6033C_1735674 URS0000D69519_12908
Length 57. 56. 58. 58.
Similarity - 0.989 0.989 0.988
Ensemble Norm 0.671 - - -
MFE -18.821 -27.757 -24.307 -15.257
Ligands - unknown unknown unknown
Gene GTF3C1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.007 7.002
Length SE - 1. 1. 1.
Lev Distance - 13. 13. 13.
UBS 5. 5. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 2. 1. 2. 3.
BR 1. 2. 2. 3.
UN 0.105 0.089 0.190 0.155

Sequences

Field Description
UTR seq + 25 augcgccccgggcgccgccgacugaaguagcaATGGACGCGCTGGAGTCGTTGTTGG
UTR dot + 25 ..(((((…)))))((.(((((..(((.((…….)))))..))))).))….
RS 1 seq GGGUGUUGCGCCGCAGCGGCGGCAAGACAGGUUUAAUGCUGGUCGGGCCGCCAGCA
RS 1 dot .((((…))))…((((((((..(((.(((…..))).)))..)))))).)).
RS 2 seq GGGUGUUCGGCGCGGCAAGGCGGCGGGCAGGGUAUUCGCGCUGGUCGGGCCGCCAGUG
RS 2 dot ..((((…))))…..((((((((.(((.((….)).))).))..))))))….
RS 3 seq GGGUGUACACGGUGCAUAUUGCUGCGUGACAGGUUUUAGCGUAGGUCGGGCCGCCACG
RS 3 dot ..((((((…))))))…((.((.(((((.((….)).)..)))).)).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table