Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047398 Similarity: 0.987 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA047398
Gene: GTPBP1
MFE: -14.227
ENS: 0.806
Length: 39.
Predicted Ligands:
SAM - 11/20
preQ_1 - 5/20
zmp-ztp - 1/20
 RS: URS00021EDBDC_12908
MFE: -10.217
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS00023316D7_471853
MFE: -15.636
Ligand: zmp-ztp
Species: Beutenbergia cavernae DSM 12333 ZMP/ZTP riboswitch
 RS: URS0000D92E6B_1802287
MFE: -9.182
Ligand: fluoride
Species: Syntrophobacterales bacterium GWC2_56_13 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047398 URS00021EDBDC_12908 URS00023316D7_471853 URS0000D92E6B_1802287
Length 39. 41. 41. 38.
Similarity - 0.987 0.983 0.982
Ensemble Norm 0.806 - - -
MFE -14.227 -10.217 -15.636 -9.182
Ligands - SAM zmp-ztp fluoride
Gene GTPBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.024 3.002 4.010
Length SE - 4. 4. 1.
Lev Distance - 13. 18. 22.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 1. 1.
H 2. 2. 2. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 1.
UN 0.154 0. 0.195 0.053

Sequences

Field Description
UTR seq + 25 cuaaguuauuaaagATGGCGACGGAGCGCAGTCGCTCCG
UTR dot + 25 ….((((((…))))))..(((((((….)))))))
RS 1 seq CCUACAACGGCUUCCUGAAGUAGGUGUUUUUUUUUGGAGCA
RS 1 dot (((((..(((….)))..)))))((((((…..))))))
RS 2 seq GUCGCGACUGGCGCCGAGGUGGAUCACCACCGGGGAGCGAC
RS 2 dot ..(((…..)))((..(((((….)))))..))……
RS 3 seq GGGGUUCACCGCAACCGCCGCUCGGCUGAUAACUCCUA
RS 3 dot (((((((((((………..))).)))..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table