Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047442 Similarity: 0.984 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA047442
Gene: GTPBP6
MFE: -29.083
ENS: 0.984
Length: 87.
Predicted Ligands:
zmp-ztp - 6/20
glycine - 5/20
cobalamin - 4/20
 RS: URS0000D816E2_999627
MFE: -32.654
Ligand: glycine
Species: Sedimentitalea nanhaiensis Glycine riboswitch
 RS: URS0000D7CEB6_1904967
MFE: -40.947
Ligand: zmp-ztp
Species: Pseudonocardia sp. CNS-004 ZMP/ZTP riboswitch
 RS: URS0000C21EC0_696281
MFE: -19.902
Ligand: zmp-ztp
Species: Desulfotomaculum ruminis DSM 2154 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047442 URS0000D816E2_999627 URS0000D7CEB6_1904967 URS0000C21EC0_696281
Length 87. 87. 86. 86.
Similarity - 0.984 0.978 0.978
Ensemble Norm 0.984 - - -
MFE -29.083 -32.654 -40.947 -19.902
Ligands - glycine zmp-ztp zmp-ztp
Gene GTPBP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 2. 3.
Length SE - 0. 1. 1.
Lev Distance - 19. 28. 28.
UBS 6. 7. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 0. 1. 1.
H 4. 4. 3. 3.
BL 1. 0. 2. 1.
BR 1. 3. 1. 1.
UN 0.126 0.115 0.128 0.128

Sequences

Field Description
UTR seq + 25 ccaggucgaacuugaaaagggacgucgcccaccuguaccgaggagucggcucgcgcuacaucATGTGGGCCCTGCGGGCCGCCGTAC
UTR dot + 25 .(((((…)))))….(((……))).(((……))).(.((((((((((((((…)))))….))))))))).)….
RS 1 seq CCUGCGCAUGCGGGAGAACCGGAUUUACCGGUGCCGAAGGAGCAACCGCCCCGGAAACUCUCAGGCCGAAGGGACCGCGGGCGUACA
RS 1 dot (((((….)))))….((((…..))))((((….).)))..((((((((…((((……..)))).))).)))))….
RS 2 seq ACGCCGGGCCGUGACUGGCGCGCUGGGAUGGGAUCGACCAUCGGGGAGCGGCCCGACCACGAGUGCCGUGCGCCUGGGCCGUCCAC
RS 2 dot .((((((…….))))))……(((((……)))))..(((.(((((((.(((((…..)))).)..))))))))))..
RS 3 seq UGGCAGUUACAUGACUGGCGGAAGAAAUGUGGAGUAUACCACAGAGGAUUGUAACUGUUGUAAAGCCGACCGCCUGGGCAAUUCAC
RS 3 dot ((.(((((….))))).))…….(((((……)))))..(((((((….((((……))))…….)))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table