Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047453 Similarity: 0.957 Similarity: 0.952 Similarity: 0.949
UTR: 5HSAA047453
Gene: GTSE1
MFE: -64.057
ENS: 0.876
Length: 180.
Predicted Ligands:
cobalamin - 15/20
lysine - 2/20
glucosamine - 2/20
 RS: URS0000C09C7B_6265
MFE: -43.816
Ligand: molybdenum
Species: Toxocara canis Moco (molybdenum cofactor) riboswitch
 RS: URS00023202D1_997347
MFE: -32.488
Ligand: cobalamin
Species: Fusobacterium nucleatum subsp. animalis ATCC 51191 Cobalamin riboswitch
 RS: URS00023151FF_190304
MFE: -28.751
Ligand: cobalamin
Species: Fusobacterium nucleatum subsp. nucleatum ATCC 25586 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047453 URS0000C09C7B_6265 URS00023202D1_997347 URS00023151FF_190304
Length 180. 179. 181. 181.
Similarity - 0.957 0.952 0.949
Ensemble Norm 0.876 - - -
MFE -64.057 -43.816 -32.488 -28.751
Ligands - molybdenum cobalamin cobalamin
Gene GTSE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 16.001 27.
Length SE - 1. 1. 1.
Lev Distance - 54. 57. 56.
UBS 10. 9. 11. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 6. 4.
ILR 7. 6. 6. 3.
H 2. 1. 1. 1.
BL 3. 2. 3. 2.
BR 0. 1. 2. 2.
UN 0.094 0.067 0.072 0.116

Sequences

Field Description
UTR seq + 25 cuacaauacccaggacgcacccagcccgccgccucucggagcccuuuucaaaccgaccaaucggcaacccgcgucucccggcgccgcguuuaaauccgugccggaggcgcguccugcaucgucugccgcuuuggugacuucugacagcucucuccATGGAAGGAGGCGGCGGCCGCGATG
UTR dot + 25 …………((……)).(((((((((((((.((((……(((…..(((((.(((((..((((((((.(((((((………….))))))))))))))………)..)))))..)))))……)))…….))))……)))))))))))..))….
RS 1 seq AUUAGUAUAAAUCUCCAANNNNNNNNNUAAGGAGAAGGUUCUAUGAUUUUUAAGCCUGGGUUACUAAAUUAUUUAACAUUAAGUUUAAUAAGAACUUAAUAUGUUAAUUAGUUUAAUUGGGGUAAUCCACAGGGUAAGGUUUGAAAGAAUUUUGCCUCCACGUAUUUUGGGAAGGAGAA
RS 1 dot ………..(((((…….((((((.((((((((((((……(((((((((((((((((((((((.((((((((((((((…..)))))))..))))))).))))))……)))))))))……..))))))))))))))))..))))…))))))…..))))).
RS 2 seq UAAAUAUCAUGUCAAUUAUGUUCCUUAUUUUUUUAAGGCUAAGAGGGAAUUCGGUGAGAUACCGAAACGAGCCCGUCGCUGUAAUUGAGUUUUUUCUUGUUUUAUACCACUGGAUUUUAUCUGGGAAGGUGAAGAAAUAUAAAUCAUAAGUCAGAAGACCUGCAUAAUUGAAUUGCUCUAU
RS 2 dot …….((..((((((((((..((((((((((((…((.(((..((((((((((.(.((..((((((((……(((…….)))…..)))))))).)))))))))))))..))).))….))))))))))…………….))….))))))))))..))……
RS 3 seq UUAAUAUCAUGUCAAUUAUGUUCCUUAUUUUUUAAGGCUAAGAGGGAAUUUGGUGAGAUACCAAAACGAGCCCGUCGCUGUAAUUGAGUUUUUUCUUGUUUUAUACCACUGGAUUUUUAUUUGGGAAGGUAAAGAAAUAUAAAUCAUAAGUCAGAAGACCUGCAUAAUUGAAUUACUCUAU
RS 3 dot ………..((((((((((((.((((((((…..(((((.((((((((((((..(((…(((((((……(((…….)))…..))))))))))..)))))))))))).))))))))))))).))……………………..))))))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table