Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047476 Similarity: 0.981 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA047476
Gene: GUCA1C
MFE: -19.989
ENS: 0.898
Length: 91.
Predicted Ligands:
zmp-ztp - 11/20
GMP - 3/20
glycine - 3/20
 RS: URS0000D6B665_304767
MFE: -18.224
Ligand: GMP
Species: Dehalobacter sp. E1 c-di-GMP-I-UAC riboswitch
 RS: URS0000C01EC1_1774971
MFE: -24.476
Ligand: cobalamin
Species: Methyloceanibacter marginalis Cobalamin riboswitch
 RS: URS0000AB635E_469381
MFE: -23.
Ligand: glycine
Species: Dethiosulfovibrio peptidovorans DSM 11002 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047476 URS0000D6B665_304767 URS0000C01EC1_1774971 URS0000AB635E_469381
Length 91. 92. 91. 91.
Similarity - 0.981 0.979 0.978
Ensemble Norm 0.898 - - -
MFE -19.989 -18.224 -24.476 -23.
Ligands - GMP cobalamin glycine
Gene GUCA1C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 5.027 12.
Length SE - 1. 0. 0.
Lev Distance - 23. 27. 25.
UBS 7. 7. 6. 8.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 1. 1. 0.
H 3. 3. 2. 2.
BL 4. 2. 3. 2.
BR 3. 2. 2. 5.
UN 0.154 0.152 0.319 0.165

Sequences

Field Description
UTR seq + 25 gggacuaaauccagcaaaaacuuaagugaaaacaaccugaggaaaagcuguagacugugagucaagATGGGGAATGGCAAATCTATAGCTG
UTR dot + 25 .(((…..)))……..((((.((…….)).))))….(((((((((.(((.(.((……..)).).)))..))))))))).
RS 1 seq ACAGGUUGAUGCAAACUUCGUGAAAGUGAAGGACGCUAAAGCUAUGGGUCUAAGGUUGCUUGUAAGUUGCUAUGAUUGCCAGGCUGCAAGUA
RS 1 dot (((((((……))))).))………((((.(………).))))…..(((((((.((((((…….))..)))))))))))
RS 2 seq UUAAGUGCCCAAAUCGACGGUCUCUCGAGAUGAGAGCGAACAGGGAACGCGGUACGGAAUUGCCCAAAUCCGCGGCUGCCCCCGCAACUGU
RS 2 dot ……………..((.((((…….)))).))….(((…(((((.(((.(((…..))))))..))))).)))……..
RS 3 seq AUGAAGGCAGUGGGAGAGUUCGAUAUAUUCGAACGCCGAAGGGGCAAGGCUUAGAGCCGAAACUCUCAGGCACAAGGACCUCUGCUGGACG
RS 3 dot …..(((………((((((…..)))))))))…..((((((((((.(.(((((…..)).))).).))).))).))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table