Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047486 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA047486
Gene: GUCY2C
MFE: -15.406
ENS: 0.814
Length: 72.
Predicted Ligands:
homocysteine - 10/20
fluoride - 8/20
purine - 1/20
 RS: URS0000D7A231_1805090
MFE: -21.146
Ligand: homocysteine
Species: Comamonadaceae bacterium CG2_30_59_20 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB5B72_338969
MFE: -24.746
Ligand: homocysteine
Species: Rhodoferax ferrireducens T118 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB47FE_748280
MFE: -28.192
Ligand: homocysteine
Species: Pseudogulbenkiania sp. NH8B S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047486 URS0000D7A231_1805090 URS0000AB5B72_338969 URS0000AB47FE_748280
Length 72. 72. 71. 71.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.814 - - -
MFE -15.406 -21.146 -24.746 -28.192
Ligands - homocysteine homocysteine homocysteine
Gene GUCY2C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 6.
Length SE - 0. 1. 1.
Lev Distance - 15. 15. 15.
UBS 5. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 2. 2. 1. 3.
H 1. 1. 1. 1.
BL 2. 1. 2. 1.
BR 2. 2. 3. 0.
UN 0.097 0.097 0.099 0.099

Sequences

Field Description
UTR seq + 25 gcaaagcaagugggcacaaggaguaugguucuaacgugauuggggucATGAAGACGTTGCTGTTGGACTTGG
UTR dot + 25 ……(((((.(((((((.(..(((((((((((…..)))))))))))….).))).))))..))))).
RS 1 seq GCUUCCAAGGAGCGUUGCAGCGGGCCGCACGGCCAGCCAGGCUUGGAUACCUUUCAACGACGCUCACCUGAU
RS 1 dot …..((.(((((((((….((((((…((((…..)))))))…)))…..)))))))).).))..
RS 2 seq UCUUCCAAGGAGCGUUGCAGUCGGCCACAUGGCCGGUCAGGCUUGGAUGACCCCAACGACGCUCACCUGAU
RS 2 dot …..((.(((((((((..((((.(((…((((…..))))))).))))…..)))))))).).))..
RS 3 seq UAAACCGAGGAGCGCUGCGAGAGGCUGUUCCCUCCCAGGCUCGGUUUCCGCAUCAACGGCGCUCACCCUCA
RS 3 dot ……(((((((((((((.(((((((..((……))..)))))))))))……)))))…)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table