Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047488 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA047488
Gene: GUCY2D
MFE: -44.146
ENS: 0.917
Length: 99.
Predicted Ligands:
TPP - 12/20
glycine - 6/20
guanidine - 1/20
 RS: URS0000D89859_1149133
MFE: -36.572
Ligand: guanidine
Species: Pseudomonas pseudoalcaligenes KF707 = NBRC 110670 Guanidine-I riboswitch
 RS: URS0000DAD2AC_193
MFE: -35.936
Ligand: TPP
Species: Azospirillum lipoferum TPP riboswitch (THI element)
 RS: URS0000C89BC0_1508404
MFE: -25.358
Ligand: TPP
Species: Jeotgalibacillus malaysiensis TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047488 URS0000D89859_1149133 URS0000DAD2AC_193 URS0000C89BC0_1508404
Length 99. 100. 98. 100.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.917 - - -
MFE -44.146 -36.572 -35.936 -25.358
Ligands - guanidine TPP TPP
Gene GUCY2D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.002 4.017
Length SE - 1. 1. 1.
Lev Distance - 30. 30. 30.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 2. 2.
H 3. 2. 2. 3.
BL 3. 4. 4. 4.
BR 3. 4. 4. 4.
UN 0.192 0. 0.143 0.060

Sequences

Field Description
UTR seq + 25 caaaagggggaccggcccugugaccccucaccgggggccgugggcccgagcccccggacuucccuaagccggcaATGACCGCCTGCGCCCGCCGAGCGG
UTR dot + 25 …..(((((..((((((((.(.(((((….)))))))).)))).))..)))))…………((.(((…….))).))..((((…))))
RS 1 seq GCAAUGGCUGGCUAGGGUUCCGGUUCGCGCAGGCGGAUGGCUGGUCCGAGAGCUGGCGACCUCCAGCGAGGUUACACGGCGGGACAAAAGCCCGGGAGAA
RS 1 dot ….(.(((((…((((((((((((.(((((.(….).)))…)).))))))).)))))))))).)……….((((.(….)))))……
RS 2 seq CGUUCACGGCUGGGGUGCCCGUCUGACGGCGGGCUGAGACCACACCCAUCGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGCCGAGCGCGCCAACGA
RS 2 dot .((((..((.((.((((((((((….)))))))….))).)).))…))))……..((.(.(((((((…….)))).))).)))…..
RS 3 seq UUUAUUUACUGGGGGAGCCGAGUGGCUGAGACAGUCUUUUGCUGAACCCUUUGUACCUGAUCUGGAUGAUGCCAGCGGAGGGAAGUAUGCUUACAUAGUU
RS 3 dot ……(((.((((((((.(((.(((((…)))))))).)))…))))).)))(((..(((((……)))).)..)))((.((((….)))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table