Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047538 Similarity: 0.980 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA047538
Gene: GUSB
MFE: -46.244
ENS: 0.817
Length: 101.
Predicted Ligands:
SAM - 5/20
glycine - 4/20
zmp-ztp - 3/20
 RS: URS0000C54A64_666686
MFE: -32.116
Ligand: SAM
Species: Bacillus sp. 1NLA3E SAM riboswitch (S box leader)
 RS: URS0000C6CD42_1736474
MFE: -48.627
Ligand: glycine
Species: Sphingopyxis sp. Root1497 Glycine riboswitch
 RS: URS0000ABC667_358681
MFE: -32.850
Ligand: SAM
Species: Brevibacillus brevis NBRC 100599 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047538 URS0000C54A64_666686 URS0000C6CD42_1736474 URS0000ABC667_358681
Length 101. 103. 102. 102.
Similarity - 0.980 0.980 0.979
Ensemble Norm 0.817 - - -
MFE -46.244 -32.116 -48.627 -32.850
Ligands - SAM glycine SAM
Gene GUSB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 3.001 6.002
Length SE - 4. 1. 1.
Lev Distance - 20. 25. 24.
UBS 9. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 3. 3. 3. 3.
H 1. 1. 1. 1.
BL 4. 3. 3. 5.
BR 2. 4. 2. 4.
UN 0.040 0.019 0.010 0.

Sequences

Field Description
UTR seq + 25 acgcgacccgcccuacgggcaccucccgcgcuuuucuuagcgccgcagacgguggccgagcgggggaccgggaagcATGGCCCGGGGGTCGGCGGTTGCCT
UTR dot + 25 ..((((((((((((.(((((.((((((.(((((……(.(((((…..))))))))))).))))…))…….))))))))).)))..)))))..
RS 1 seq AUCUUAUCAAGAGAGGCAGAGGGACUGGCCCUGUGACGCCCAGCAACCGGUAUGGAACACGGUGCUAAUUCCAGCAGAGUCUGUUUACUCUGGGAGAUAAGAA
RS 1 dot .(((((((.(((((((((((((((.((((.(((((….(((((…..)).)))..))))).)))).))))…….))))))).))))….))))))).
RS 2 seq ACCGGCCGCGCGGGAGAGCGCGAGGGCGGGGUCACCCGUGCUUCGCCACCGAAGGAGCAACCGCCCCGGAAACUCUCAGGUCAAGCGGACCGCGCAGGCCGG
RS 2 dot .(((((((((((((((((..((.((((((.((……(.(((((….))))).)))..))))))))….)))))…………)))))).))))))
RS 3 seq CUCUUAUCCAGAGCAGGCGGAGGGACUGGCCCUAUGAAGCCCGGCAACCGAGCUAGAGCGGUGCUAACCAGCAGAACGGACAUCUGUUCUGGCCGAUAAGAG
RS 3 dot ((((((((((((((((((((.((.(((.((.((….(((.(((…))).))))).))))).))..)).))………..)))))))))…)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table