Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047816 Similarity: 0.994 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA047816
Gene: HAO1
MFE: -9.709
ENS: 0.986
Length: 49.
Predicted Ligands:
SAM - 18/20
preQ_1 - 2/20

 RS: URS0000AB8D34_115778
MFE: -7.499
Ligand: preQ_1
Species: Leuconostoc gelidum subsp. gasicomitatum PreQ1
 RS: URS0000AB2AFF_408172
MFE: -10.099
Ligand: SAM
Species: marine metagenome SAM/SAH riboswitch
 RS: URS0000AB9108_388401
MFE: -14.309
Ligand: SAM
Species: Rhodobacteraceae bacterium HTCC2150 SAM/SAH riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047816 URS0000AB8D34_115778 URS0000AB2AFF_408172 URS0000AB9108_388401
Length 49. 48. 48. 49.
Similarity - 0.994 0.991 0.991
Ensemble Norm 0.986 - - -
MFE -9.709 -7.499 -10.099 -14.309
Ligands - preQ_1 SAM SAM
Gene HAO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 3. 3.007
Length SE - 1. 1. 0.
Lev Distance - 6. 10. 12.
UBS 2. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 2. 1.
H 1. 1. 1. 1.
BL 0. 1. 1. 1.
BR 0. 1. 0. 1.
UN 0.265 0.312 0.271 0.347

Sequences

Field Description
UTR seq + 25 cugggauagcaauaaccugugaaaATGCTCCCCCGGCTAATTTGTATCA
UTR dot + 25 (((((..((((…………..))))..)))))………….
RS 1 seq UUGUUAGCGGUUCAUCAACCUUCCCGCUUAUAAAAAAACUAGGAGAUG
RS 1 dot ((((.(((((………….))))).))))……………
RS 2 seq UGAUGCACGCAACGGCUUCCUGACGCGUGAGAUUAAAUUAUUGGAGCA
RS 2 dot ((((.(((((..(((….)))..)))))..))))………….
RS 3 seq UGUCCCCCUCAACGGCUUCCUGACGAGGCGGGCUUAACAAAACGGAGCA
RS 3 dot .((((.((((..(((….)))..)))).))))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table