Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047817 Similarity: 0.967 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA047817
Gene: HAO1_0
MFE: -16.298
ENS: 0.975
Length: 123.
Predicted Ligands:
TPP - 9/20
FMN - 7/20
molybdenum - 1/20
 RS: URS0000AB1A14_767817
MFE: -33.855
Ligand: molybdenum
Species: Desulfotomaculum gibsoniae DSM 7213 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C0BBF8_1487956
MFE: -28.311
Ligand: TPP
Species: Corynebacterium sp. ATCC 6931 TPP riboswitch (THI element)
 RS: URS0000C1A9C4_1129794
MFE: -32.021
Ligand: TPP
Species: Paraglaciecola psychrophila 170 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047817 URS0000AB1A14_767817 URS0000C0BBF8_1487956 URS0000C1A9C4_1129794
Length 123. 123. 122. 123.
Similarity - 0.967 0.964 0.962
Ensemble Norm 0.975 - - -
MFE -16.298 -33.855 -28.311 -32.021
Ligands - molybdenum TPP TPP
Gene HAO1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.017 13.026 14.026
Length SE - 0. 1. 0.
Lev Distance - 42. 44. 47.
UBS 4. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 3.
ILR 2. 3. 3. 3.
H 2. 3. 3. 3.
BL 0. 1. 0. 1.
BR 0. 0. 1. 1.
UN 0.382 0.252 0.221 0.220

Sequences

Field Description
UTR seq + 25 aauaauugacaaauaacagaacagugaggauguagaaagcaauacauuaaaaaaaaaaaaacaacgaacuccaucugggauagcaauaaccugugaaaATGCTCCCCCGGCTAATTTGTATCA
UTR dot + 25 ……………………….((((((……..))))))……………(((((……(((((..((((…………..))))..)))))….)))))….
RS 1 seq ACAUUUUUAUUUUUCCGAAUCUGUUCGCCUGUAGUCAAUAAGACUAUGGCGGCGAAUCUAUACAUGGUGCGCCUGGAAACGGGCUGGCCUCCCAUUGUGGAAAGGAGCCUUCAUUAUCUGGAC
RS 1 dot ………………….(((((((.((((((…..))))))…)))))))……..(((..(((((….)))))..)))(((….(((((……..)))))…..))).
RS 2 seq UUACAAAACCACGGGAGUGCCAACCGAAAUUCCGGCACUGAGAGGACGCUAGGGAUCGAGCGUCGACCGGACGAACCUGAAUCUGGGUAAUACCAGCGUAGGAAAGGGAUGUGUUGCUUCAU
RS 2 dot ……………((((((…………))))))…..((((((……..))))))(((((..(…((((…((((……))))..))))….)..)).)))…….
RS 3 seq UUUUUCUUGUCGGAGUGCUAGUGUUUUUUACUGAGGUGAAAAACAUAAGCUGAGACCGUUAAUUCGGGAUCCGUUGAACCUGAUCGGGCUAGUACCCGCGAAGGAAACAAGCGUAAUGUUAUU
RS 3 dot …………….(((.(((((((((((….))))))))))).))).((..(((……)))..))((((…(((…((((……))))…)))…..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table