Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047880 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA047880
Gene: HAT1
MFE: -25.631
ENS: 0.740
Length: 78.
Predicted Ligands:
SAM - 13/20
homocysteine - 3/20
fluoride - 3/20
 RS: URS0000AB334A_287752
MFE: -18.950
Ligand: SAM
Species: Aurantimonas manganoxydans SI85-9A1 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000DB5E33_1896170
MFE: -28.042
Ligand: homocysteine
Species: Burkholderiales bacterium 68-12 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BFF99F_1189611
MFE: -21.154
Ligand: SAM
Species: Nitratireductor aquibiodomus RA22 SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047880 URS0000AB334A_287752 URS0000DB5E33_1896170 URS0000BFF99F_1189611
Length 78. 78. 78. 78.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.740 - - -
MFE -25.631 -18.950 -28.042 -21.154
Ligands - SAM homocysteine SAM
Gene HAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 4.011 4.
Length SE - 0. 0. 0.
Lev Distance - 16. 16. 17.
UBS 6. 7. 5. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 3.
ILR 1. 2. 2. 2.
H 1. 1. 1. 1.
BL 3. 2. 3. 3.
BR 2. 2. 1. 3.
UN 0.103 0.128 0.205 0.103

Sequences

Field Description
UTR seq + 25 gagcgcgcggguugauucguccuuccucagccgcgggugaucguagcucggaaATGGCGGGATTTGGTGCTATGGAGA
UTR dot + 25 .(((((.((((((…(((((.((((..(((.((((….)))).))).))))..))))))))))))))))…….
RS 1 seq CAAAGCAGAAGUGGUGAUUUGGCCGGCCGGCUUGCAGCCACGUUAAAGAAGUCGCUAAAGGGCCGUUCUGACGAUAUG
RS 1 dot ….((((((.((((..(((((.((((…(((..(((…))).)))..)))))))))..))))))))).)……
RS 2 seq CUUCCCAAGGAGCGUUGCAGCGGGCCGGUGCAUGGCCCGUCAGGCUUGGGCUGAUCUUGUCAACGGCGCUCACCUGUC
RS 2 dot ………((((((((..(((((.((((.((.((((…..)))))).))))..)))))…))))))))…….
RS 3 seq ACCUUCACUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUAAAACAAUUCGCUAAAAGGCCGAGCGAAGCAGAAU
RS 3 dot ..((((.(((..(((..((((((.(((.(..((((……))))..).))).))))))..)))))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table