Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA047883-0 Similarity: 0.986 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA047883-0
Gene: HAT1_0
MFE: -32.193
ENS: 0.794
Length: 91.
Predicted Ligands:
TPP - 6/20
glycine - 6/20
zmp-ztp - 5/20
RS: URS0000C3A79E_1531966
MFE: -21.662
Ligand: TPP
Species: Torrubiella hemipterigena TPP riboswitch (THI element)
RS: URS0000C3BD04_5601
MFE: -24.193
Ligand: TPP
Species: Capronia semiimmersa TPP riboswitch (THI element)
RS: URS0000C32D33_1703392
MFE: -24.966
Ligand: Ni/Co
Species: Dehalococcoidia bacterium DG_18 NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA047883-0 URS0000C3A79E_1531966 URS0000C3BD04_5601 URS0000C32D33_1703392
Length 91. 90. 91. 92.
Similarity - 0.986 0.982 0.982
Ensemble Norm 0.794 - - -
MFE -32.193 -21.662 -24.193 -24.966
Ligands - TPP TPP Ni/Co
Gene HAT1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.001 10.001 10.001
Length SE - 1. 0. 1.
Lev Distance - 17. 20. 20.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 2. 4. 2.
H 2. 2. 2. 2.
BL 3. 3. 1. 1.
BR 2. 3. 1. 4.
UN 0.077 0.111 0.110 0.109

Sequences

Field Description
UTR seq + 25 acuuccggcccgggagcgcgcggguugauucguccuuccucagccgcgggugaucguagcucggaaATGGCGGGATTTGGTGCTATGGAGA
UTR dot + 25 ..(((((((.(((..((.(((.((((((………..))))))))).))..)))..)).)))))((((((……..))))))…..
RS 1 seq AGGCUGUUGCGAUGGAGCUUGUGGCUGAGAAUAUACGGCCCUGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCCUUCCUCCAUC
RS 1 dot ..((((((..(((.(((.(((.(((((……..))))).))).))).)))..))……))))…((((……..))))…..
RS 2 seq CGUCGCUGGAUCGUGGAGAGUUGCGUUCUGAGAUCAUACGGUUUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCUUGCGAUCUCUUCUU
RS 2 dot ..((((((((((..((.(((((((((..((….)).)))…))))))..))..)))….)))))))..(((((….)))))……
RS 3 seq AAAUUAGAGUUGGAGCAGGCGACCUUAAUGACGUUUUAAGGUGCAGCCGGGCUGGGCUUCUGGCAACGGUACUUUGAGACCGCGGGACUAUG
RS 3 dot …((((((((..(((.(((((((((((…….))))))).).)))..))).)))).))))(..((((……..))))..)…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table