Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048031 Similarity: 0.972 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA048031
Gene: HBP1
MFE: -26.485
ENS: 0.971
Length: 107.
Predicted Ligands:
TPP - 9/20
SAM - 6/20
Mg2+ - 2/20
 RS: URS0000D675A9_12908
MFE: -17.963
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
 RS: URS0000C10A50_1441095
MFE: -29.624
Ligand: SAM
Species: Bacillus gobiensis SAM riboswitch (S box leader)
 RS: URS0000D6C51E_12908
MFE: -17.463
Ligand: SAM
Species: unclassified sequences SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048031 URS0000D675A9_12908 URS0000C10A50_1441095 URS0000D6C51E_12908
Length 107. 107. 107. 106.
Similarity - 0.972 0.971 0.971
Ensemble Norm 0.971 - - -
MFE -26.485 -17.963 -29.624 -17.463
Ligands - SAM SAM SAM
Gene HBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.017 3.002 3.018
Length SE - 0. 0. 1.
Lev Distance - 37. 38. 37.
UBS 6. 6. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 3. 2. 3. 2.
H 3. 3. 3. 3.
BL 1. 2. 1. 2.
BR 0. 0. 1. 0.
UN 0.056 0.187 0.103 0.189

Sequences

Field Description
UTR seq + 25 aacccccaggggguugaggggagggggaagacgaagcuugaaagacuugguaauggcgacggguuugucagagcaccauaacATGGTGTGGGAAGTGAAGACAAATC
UTR dot + 25 ..(((((……………)))))….((..(((…………….)))..))((((((((…((.(((((……)))))…))…))))))))
RS 1 seq UCGAAACAUCAAGAGCAGUUUAAAAUCUGCACCAACCGAGCACGACAGCCACGGUGGUCAAGAUACGAUGUGGAAAUAAGUUUAAUUUCAAAAAUAAGUCUUUAUGA
RS 1 dot …………..((((……..))))(((.((((.((……))..))))))).(((((……..(((((…….)))))……..)))))…..
RS 2 seq UACUUAUCCAGAGCGGCGGAGGGACUGGCCCAAUGAAACUCGGGAAACCAGCAGAAUCACUAUGUUGCUCAUUCCAGGAACACAUGGUUGUGUUCAAAAGAUGGGGA
RS 2 dot ……(((.(((…((..(((…..)))..))…))).)))…(((((………)))))((((((….(((((((….)))))))….))))))..
RS 3 seq UCGAAACAUCAAGAGCAGUAUUAAUCUGCACCAACCGAGCACGACAGCCACGGUGGUCAAGAUACGAUGUGGAAAUAAGUUUAAUUUCAAAAAUAAGUCUUUAUGA
RS 3 dot …………..((((…….))))(((.((((.((……))..))))))).(((((……..(((((…….)))))……..)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table