Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048032 Similarity: 0.978 Similarity: 0.978 Similarity: 0.977
UTR: 5HSAA048032
Gene: HBP1_0
MFE: -23.306
ENS: 0.926
Length: 103.
Predicted Ligands:
TPP - 13/20
purine - 4/20
preQ_1 - 2/20
 RS: URS0000D9899E_61015
MFE: -16.988
Ligand: purine
Species: Staphylococcus succinus Purine riboswitch
 RS: URS000041A43E_1209989
MFE: -28.791
Ligand: TPP
Species: Tepidanaerobacter acetatoxydans Re1 TPP riboswitch (THI element)
 RS: URS0000AB884E_176279
MFE: -21.508
Ligand: TPP
Species: Staphylococcus epidermidis RP62A TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048032 URS0000D9899E_61015 URS000041A43E_1209989 URS0000AB884E_176279
Length 103. 103. 104. 103.
Similarity - 0.978 0.978 0.977
Ensemble Norm 0.926 - - -
MFE -23.306 -16.988 -28.791 -21.508
Ligands - purine TPP TPP
Gene HBP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 2.004 1.002
Length SE - 0. 1. 0.
Lev Distance - 28. 28. 31.
UBS 7. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 0. 0. 1.
H 3. 3. 3. 3.
BL 2. 1. 2. 1.
BR 3. 2. 4. 3.
UN 0.252 0.272 0.192 0.301

Sequences

Field Description
UTR seq + 25 aacccccaggggguugaggggagggggaagacgaagcuugaaagacuugguaauggcgacggguuugagcaccauaacATGGTGTGGGAAGTGAAGACAAATC
UTR dot + 25 ..(((((……………)))))…((.(((((….)).))).))……….(.(((..(((((((…)))))))..))).)………..
RS 1 seq CAGUUAAUAAUUUAUCUAACUCAUAUAAUCUAAAGGAUACGGCUUUAGAAGUUUCUACCAUGUCGCCAUUAACGAUGUGACUAUGAGUAACCUAUACAAUACA
RS 1 dot .(((((……….)))))…….(((((((…….)))))))……((((((((((.((((…)))))))).))).)))…………..
RS 2 seq UAUGUCCACUAGGGGAGCGCGGAUAGCUGAGAUAGUGAGUAAACUCACUGACCCUUGAACCUGCUCUAGGUAAUGCUAGCGUAGGGAAGUGGUUUUAGUAUGUA
RS 2 dot ..(((((.(………).)))))…….(((((((….)))))))((((((…(((((.((((……)))).))))).))).)))………..
RS 3 seq UGAACGCACUAGGGGUGUAUUCUUUACUGAGAUGAGGCCAACCUCAAACCCUUCGAACCUGAUCUAGCUAGUUACUAGCGUAGGAAAGUGUUGUUAUACAUCU
RS 3 dot .(((.(((((…))))).)))……….(((((….)))))………(((((..((((((((…..)))).))))..)).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table