Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048210 Similarity: 0.970 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA048210
Gene: HDAC6
MFE: -46.875
ENS: 0.935
Length: 129.
Predicted Ligands:
cobalamin - 16/20
tetrahydrofolate - 2/20
homocysteine - 1/20
 RS: URS0002328DD0_68231
MFE: -48.877
Ligand: cobalamin
Species: Streptomyces longwoodensis Cobalamin riboswitch
 RS: URS000231CE50_1415557
MFE: -46.185
Ligand: cobalamin
Species: Streptomyces sp. WM6378 Cobalamin riboswitch
 RS: URS000231EA01_103690
MFE: -31.945
Ligand: cobalamin
Species: Nostoc sp. PCC 7120 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048210 URS0002328DD0_68231 URS000231CE50_1415557 URS000231EA01_103690
Length 129. 130. 129. 130.
Similarity - 0.970 0.970 0.969
Ensemble Norm 0.935 - - -
MFE -46.875 -48.877 -46.185 -31.945
Ligands - cobalamin cobalamin cobalamin
Gene HDAC6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 5. 6.
Length SE - 1. 0. 1.
Lev Distance - 36. 39. 38.
UBS 7. 7. 7. 7.
BS 5. 4. 4. 4.
ILL 2. 1. 1. 2.
ILR 1. 3. 2. 1.
H 3. 2. 2. 3.
BL 4. 3. 4. 3.
BR 3. 3. 4. 5.
UN 0.124 0.162 0.140 0.146

Sequences

Field Description
UTR seq + 25 gaccgaaggcggcuagggacuggcugaagaggguacagcgcgucgacggcggaggcgggaagggggcggaggccaaccgcggcaggggccaagccuccucaacuATGACCTCAACCGGCCAGGATTCCA
UTR dot + 25 ..(((….)))…(((((((((((..((((.((.(((((.((…….)).))).(.(((((((…((((..((……))))))..))))))))..)).)).))))…)))))))..)))).
RS 1 seq AAGAUGUAUGCUCAUGCUCGCUGUCGCCGCAGGGGAAUCCGGUGUGAGUCCGGAACUGUCCCGCAACGGUGUACCCGUGCGUUCGCGCACGGGCGUCAGUCCGAGGACCUGCCGACAGUGCGCCCAGGCC
RS 1 dot ………(((…((.((((((((..((((((((.(((((…….)))))….)))).(..((((((.((((((((….)))))))).).))..)))..)..)))))))))))).))…))).
RS 2 seq ACAUGUAUGCUCGUCCUCGCUGUCGCCGCAGGGGAAUCCGGUUCGAAUCCGGAACUGUCCCGCAACGGUAUGACCCGUACCCCUUUGUACGGGCCGAGUCCGAUGACCUGCCGAUGGCGCGUCCGGGUC
RS 2 dot ……..(((((..(.((((((((..((((((((.(((((…….)))))….)))).((.(((..((.(((((((……))))))).).)..))).))..)))))))))))).)..))))).
RS 3 seq GGUAGAUUACUAGAACUUGGUGUUGGGAAACUCCGGUGCGAUUCCGGGGCUGUGCCGCAGCUGUGAUGAAAAGUCCCAAGAAUUUCUCUUGUAACUUUCCGAGUCAGAAUGCCAAUUCCAAGAGUUAGCU
RS 3 dot ………((((..(((((.(((((.(..((((((…….))))))((((…))))((((..((.(((((..(((((…..)))))..))))).)).).)))..).))))).)))))..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table