Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048213 Similarity: 0.950 Similarity: 0.947 Similarity: 0.945
UTR: 5HSAA048213
Gene: HDAC6_0
MFE: -55.894
ENS: 0.992
Length: 166.
Predicted Ligands:
Mg2+ - 8/20
cobalamin - 6/20
FMN - 5/20
 RS: URS0000C65A85_797515
MFE: -30.952
Ligand: Mg2+
Species: Lactobacillus parafarraginis F0439 M-box riboswitch (ykoK leader)
 RS: URS000074AE5A_1365665
MFE: -59.421
Ligand: FMN
Species: Pseudomonas syringae pv. syringae str. B301D-R FMN
 RS: URS000007EAAF_410659
MFE: -60.565
Ligand: cobalamin
Species: mine drainage metagenome Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048213 URS0000C65A85_797515 URS000074AE5A_1365665 URS000007EAAF_410659
Length 166. 165. 166. 168.
Similarity - 0.950 0.947 0.945
Ensemble Norm 0.992 - - -
MFE -55.894 -30.952 -59.421 -60.565
Ligands - Mg2+ FMN cobalamin
Gene HDAC6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 22.015 23.003 2.
Length SE - 1. 0. 4.
Lev Distance - 51. 56. 67.
UBS 14. 12. 14. 14.
BS 0. 0. 1. 0.
ILL 3. 1. 2. 3.
ILR 7. 4. 3. 6.
H 3. 3. 3. 3.
BL 6. 4. 7. 6.
BR 4. 5. 6. 5.
UN 0.042 0.164 0.096 0.060

Sequences

Field Description
UTR seq + 25 gaucuggcggaguggaagguaccgguccggcccgauaagggguggaguuaagugaaucguuaaggguggagucgaaaccggggucggggccggggccggcugagugaaaggaaccgcggcaggggccaagccuccucaacuATGACCTCAACCGGCCAGGATTCCA
UTR dot + 25 …..(.((((.(((……))).)))).)((..(((.((……………)).)))..)).((((((….(((((((((((((..((.((.((((.((…….))..))))..)).))..)))))………))))….))))….)))))).
RS 1 seq AAUAGAGGCUGUUAGGUGAGGCUCCUAUGUGGAAAAUGCUACUGCUCAGAAACGUCGAAAAACGCCAAUGAGUCAGCUGUUCUAGUCAAAGUAAGGCUUGAACUAACGUAGCUGUUAUUUAUAACUACAACACAUAGUGCUAAAGCUCAACGACUGGCGAUAAGU
RS 1 dot .((((((.((……..)).))).)))((((……))))………………..(((((.(((((.(((((((.((((..((((((((((((……)).)))).))))))…)))).))))……)))…)))))…..)))))……
RS 2 seq CAACGUUCUCAGGGCGGGGUGCAAUUCCCCACCGGCGGUAAUGACGCGCAAUGCGUCUAGCCCGCGAGCGCUUGGGGGUCGUGGCUUUGGCUGCUAUCUGCAAGGUCAGCAGACCCGGUGUGAUUCCGGGGCCGACGGUCAUAGUCCGGAUGAAGAGAGAGCGGGA
RS 2 dot …(((((((..((.((((…….)))).)).((((….(((((…..)))))….))))…((.((.(((.(.((((((((((((.(.((((((..((((….))))..))).)))…).)))))).))))))).))).))))….)))))))…
RS 3 seq UACGCGCCGCUACGCCCGGGUGCGGGAAGCCGGUGAGAAUCCGGCACGGUCGCGCCACUGUCAGCGGGGAGCCGCCAUUUGUCACUAUCGCCUCGGCGACGGGAAGACAGACGGCAAGAGGCAACGAUCCGCAGAGUCAGGAUACCGGUCCCGGAGCGCUUUGCAUCA
RS 3 dot ……((((((((….(((((((…(((((…….)))))….)))))))..))).)))))(((.(.(((.((((((.((.((..((((….))))..)).))..)))))).)))…).)))((((((((.((((….)))).)….)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table