Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048254 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA048254
Gene: HDGF
MFE: -31.385
ENS: 0.828
Length: 90.
Predicted Ligands:
Ni/Co - 7/20
glycine - 7/20
TPP - 3/20
 RS: URS0000C18587_518636
MFE: -39.259
Ligand: Ni/Co
Species: Clostridium asparagiforme DSM 15981 NiCo riboswitch
 RS: URS0000C4EF64_1263009
MFE: -24.493
Ligand: Ni/Co
Species: Firmicutes bacterium CAG:212 NiCo riboswitch
 RS: URS0000C1237C_1196322
MFE: -22.041
Ligand: Ni/Co
Species: Clostridium sp. Maddingley MBC34-26 NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048254 URS0000C18587_518636 URS0000C4EF64_1263009 URS0000C1237C_1196322
Length 90. 92. 91. 91.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.828 - - -
MFE -31.385 -39.259 -24.493 -22.041
Ligands - Ni/Co Ni/Co Ni/Co
Gene HDGF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.004 4.001 10.
Length SE - 4. 1. 1.
Lev Distance - 18. 24. 22.
UBS 6. 5. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 1. 0. 0. 0.
H 3. 3. 3. 3.
BL 3. 1. 2. 1.
BR 0. 2. 1. 2.
UN 0.256 0.315 0.220 0.264

Sequences

Field Description
UTR seq + 25 aaacacaaacaacugcacgagcgcgcacccaccgcgccggagcccggggcgcccggagccccgccATGGAGCAGAGGGCAGGCGGAAACC
UTR dot + 25 …………..((.((.(((((…….)))))))..))(((((…)))))….(((((.((……….)))))))…..
RS 1 seq AUGGCAUAAAGGAAACAGGCCGCGGGCGGCAGCGCGCGGGCCGGGCCGCAUUAGCGGCAGCAGGUGGAUCAGGCGGCAUCUGCGGGACAAUG
RS 1 dot ……………..(((((((.((….)).))))).))..(((((….))))).(((((((……….)))))))………
RS 2 seq ACAGUACAAACUGAGCAGACCGUGAUAGAUUAUCAUGGAGUCGGGUCACACAGGUGACAGUGGAAUGAAUCUUUGCAUCCACGGGACAGUA
RS 2 dot ……….((((.(…((((((((…)))))))).)))))(((((….))))).((((.(((……..)))))))………
RS 3 seq AUAAUUUAACUAAGCAGGCCAUGAACUUGUAAAAGGUUUGUAGGCUGGGCCUUAAUUGGCAGCAGGAUAGUAAUGAACCUGUGGGACAAUA
RS 3 dot …………..(.((((((((((((…..)))))))).)))).)(((……))).(((((………..)))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table