Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048713 Similarity: 0.966 Similarity: 0.966 Similarity: 0.966
UTR: 5HSAA048713
Gene: HDX
MFE: -32.421
ENS: 0.842
Length: 134.
Predicted Ligands:
TPP - 8/20
FMN - 5/20
cobalamin - 4/20
 RS: URS0000D8DBE2_1416753
MFE: -51.714
Ligand: TPP
Species: Ensifer adhaerens OV14 TPP riboswitch (THI element)
 RS: URS00023342A3_1193518
MFE: -55.756
Ligand: cobalamin
Species: Tetrasphaera jenkinsii Ben 74 Cobalamin riboswitch
 RS: URS0000D9BB26_1586290
MFE: -47.187
Ligand: FMN
Species: Geobacillus sp. B4113_201601 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048713 URS0000D8DBE2_1416753 URS00023342A3_1193518 URS0000D9BB26_1586290
Length 134. 132. 134. 134.
Similarity - 0.966 0.966 0.966
Ensemble Norm 0.842 - - -
MFE -32.421 -51.714 -55.756 -47.187
Ligands - TPP cobalamin FMN
Gene HDX - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4. 6.
Length SE - 4. 0. 0.
Lev Distance - 37. 44. 43.
UBS 12. 12. 13. 12.
BS 0. 0. 0. 1.
ILL 1. 2. 2. 2.
ILR 2. 3. 3. 2.
H 3. 3. 3. 3.
BL 6. 4. 6. 4.
BR 4. 3. 5. 4.
UN 0.075 0.061 0.060 0.082

Sequences

Field Description
UTR seq + 25 gucugaagcggcacuggagacccaggaaaaaucucgcugaauccgccugccccagcagcggccugaucuggguuccgcugauuccuuucguaaccgcaccacacccgagATGAGTAGTAAGAACTCTGAATCTG
UTR dot + 25 ……((((((.((((….)))))…….)))))….(((.((((….)))))))(..((((.((((((.(((.((((.(((((……………))))).)))))))..)))))).)).)).)
RS 1 seq GGCAUUCACCAGGGGGGUCCCGUCAAGGGGCUGAGAUACUGCUGGGCGGAUCGGCUUUGCCGACCGAGGCGCAGUGACCCGUUGAACCUGAUCCAGUUCAUACUGGCGUAGGGACGGUGCAGACAUUGACGC
RS 1 dot ……(.((((.((((((((…..))))))……)).)))))(((.(((((…))))))))..((((((((.((((((…((((..(((((….)))))..))))))))).)….))))).)))
RS 2 seq GUCUCGGGUCCGAGGCCUGGUGCUAGGUUGGCCGGGCGUCGAGCAGGGAAAGUCCGGUGAGAUCCCGGCGCUGACCCGCAACGGUGACCGCUACGGCGGCGAGCCCGAAUGCCUGUGCGGCGCAGUCCGGUUGC
RS 2 dot …….((.(((.(((((((………))))))).))).)).(((..(((((((.(….))))).)))..)))(((((.(.(((((((.((..((((……..))))..)).))))..)))).)))))
RS 3 seq UGCAUCCUUCGGGGCAGGGUGAAAUUCCCGACCGGCGGUGAUGAGGCGACGCGCCUCUCAGCCCGCGAGCCUGAUUGGCACGAUCCGGUGCGAUUCCGGAGCCGACAGUAUAGUCUGGAUGGGAGAAGGAUGGC
RS 3 dot ..((((((((..((..(((…….)))..))…(.(((.((((((…))))))))).)((((.((((((.(((((….(((((…….)))))))))))))….).)).).)))..))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table