Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048883 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA048883
Gene: HELT
MFE: -42.247
ENS: 0.894
Length: 113.
Predicted Ligands:
TPP - 12/20
methionine - 3/20
SAM - 3/20
 RS: URS0000C0A3B3_1894
MFE: -46.157
Ligand: TPP
Species: Streptomyces aureofaciens TPP riboswitch (THI element)
 RS: URS0000D7F545_629680
MFE: -51.403
Ligand: methionine
Species: Brevibacterium sp. 01-Je-003 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000DAE7B1_1304903
MFE: -37.048
Ligand: cobalamin
Species: Alteromonadaceae bacterium Bs31 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048883 URS0000C0A3B3_1894 URS0000D7F545_629680 URS0000DAE7B1_1304903
Length 113. 113. 112. 114.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.894 - - -
MFE -42.247 -46.157 -51.403 -37.048
Ligands - TPP methionine cobalamin
Gene HELT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 5.013 4.
Length SE - 0. 1. 1.
Lev Distance - 34. 33. 34.
UBS 9. 10. 10. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 4. 2.
ILR 3. 3. 4. 2.
H 3. 4. 3. 3.
BL 3. 4. 2. 3.
BR 1. 1. 2. 2.
UN 0.150 0.097 0.036 0.149

Sequences

Field Description
UTR seq + 25 accugggacacucgaggaggcacacgaggcggaaaaguggacgggugccccgcgccaccgccucucccgagggcgcguacugaccaggATGTCAGACAAGCTCAAGGAACGCA
UTR dot + 25 .(((.((….)).)))……..(((((((…..(((.((((…))))..))))))))))..((..((((..((.(((((……)))))))..))))..))……
RS 1 seq GGGGCACCACACGGGAGCCCGGCGAACCGGGCUGAGAGGCGGGCUGGCACGGCCCGCGACCGUCCGAACCUGAUCCGGGUCAUACCGGCGAAGGGAGAAGAGCAGCUUUGUCA
RS 1 dot .((((.((….))..))))…….(((((.(.(..((((((((…))))))))..)))))))..(((…((((……))))…)))((.(((……))).)).
RS 2 seq GUUCACGAGUCGUGGCCAUCGGUACCUGGCCGGCCACGCGGCAACCCGUCAUCGACCGGGUGCCCCAGGGAAAGAACGGGCCGAUGCCACGUGGCAUCGGCAAGAUUCGAUC
RS 2 dot …((((…)))).((…(((((((((.(((..(((.((…)))))..))).)))))))))…))((..((((..(((((((((….)))))))))..).)))..))
RS 3 seq AAGUCGCGCCUCGUUCCAGGUGCCACAGAUCUUUGUGGCCAAAUGGGAAGACCGGUGAAAGUCCGGCGCUGCCCCCGCAACGGUAAGUGAGUUUUUCUCACCAGCCCGACACCA
RS 3 dot ..((.((((((……)))))).))……((((((……(((.((.((((…….))))..)).))))))))).(((..(((((…..)))))..)))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table