Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048932 Similarity: 0.947 Similarity: 0.946 Similarity: 0.946
UTR: 5HSAA048932
Gene: HERC3
MFE: -62.192
ENS: 0.675
Length: 199.
Predicted Ligands:
cobalamin - 13/20
lysine - 5/20
FMN - 1/20
 RS: URS000232526A_1406840
MFE: -63.179
Ligand: cobalamin
Species: Flavobacterium beibuense F44-8 Cobalamin riboswitch
 RS: URS0000BECDE4_169760
MFE: -79.822
Ligand: lysine
Species: Paenibacillus stellifer Lysine riboswitch
 RS: URS0000A41669_1639
MFE: -43.244
Ligand: lysine
Species: Listeria monocytogenes Lysine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048932 URS000232526A_1406840 URS0000BECDE4_169760 URS0000A41669_1639
Length 199. 197. 198. 198.
Similarity - 0.947 0.946 0.946
Ensemble Norm 0.675 - - -
MFE -62.192 -63.179 -79.822 -43.244
Ligands - cobalamin lysine lysine
Gene HERC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.001 3.006 7.
Length SE - 4. 1. 1.
Lev Distance - 56. 69. 67.
UBS 15. 15. 16. 14.
BS 0. 0. 0. 0.
ILL 5. 6. 4. 3.
ILR 4. 1. 4. 5.
H 5. 5. 5. 5.
BL 5. 4. 6. 4.
BR 3. 5. 3. 3.
UN 0.060 0.091 0.136 0.076

Sequences

Field Description
UTR seq + 25 guguguacggguguguguguguguguacgccgacacgucggugcggaccgacgcgggggugucaggagcugggacggccgggggcagaacugcaagguguggaauauuucuggcuucuaguccaaugccaagugugugaccuguggcuacaugauucccugaaagauaagaacaATGTTATGTTGGGGATATTGGTCTC
UTR dot + 25 ((.(((((.(((((((..((((….))))..))))))).))))).)).(((((….))))).(((.(((((..(((((((((…..(((((…)))))….)))))))))))))))))…((((.((…..))…))))..((..((((((…((.((((……..)))).))))))))..))…..
RS 1 seq CACCCAACUUUAGGUUAUAGUGUGCCGGCCGCACACUGUAUUAAAAGGGAAUCAGGUGUAAUACCUGAGCUGUUCCCGCAACUGUAAGCUAUAUCCCUUUUGGGAGGCUGUUGUUAACUGCGAGCCACUGCCUGUAUGGGCGGGAAGGUAAACAACAGUACGCAAGCCAGGAGACCUGCCUUUAGUGUUAACAAUUA
RS 1 dot ..(((…(((((..((((((((((…..))))))))))))))).)))..(((((((…)))))))((.(((…(((((….((((…((((….))))))))))))).))).))..(((.((((((….))))))…)))….((((.((…(((.((((…)))).))))).))))……..
RS 2 seq AGAUGAGGUAGAGGUCGCGGAUAUGAAGAGUACGCGCGGGGAGACGUCAAAGAGCCGUCCACGAACCGCCGCGGAAAGGCAUAGCCGCCGAAGUCCAUGCCGCCGCUCUUGUCCGGCAUGGACUGGGGCCGUACCCGAAAGGGACGGAACUGUCACGCCUGCGAAGCUUGCUUCGCGGCGUGUUGCGCUAUCUUCACU
RS 2 dot …(((.((…..(((((..(((…..)))..)))))….)).)))….(((.(((.((……)).)))..)))….((.((..(((((((((((..((….)).)))))))))))))))((((.(((….)))))))….((((((((.((((((….))))))))))))..))…………
RS 3 seq UGGUGAGGUAGAGGUUGCGAGAUUCACUAGUAAUUUUUUCGAGGCGAAACAAAGACGCCGACGACAAAGAAUGAACAGGUUGAUCGCCGAAGUGACUAUUUUCUCUUUGUUUAGAAAUAGUUGUUGGGACAGUUUCCUAAAGGGGCUGGACUGCUAUAAGAAUUUGUCGAAAUUUCUUAUAGGUGUGCUAUCUGACAA
RS 3 dot ((.(..((.(((((((((.((…..)).)))))))))))..).))………..((((((((……((((((((..((((((….))))……))..))))))))……))))))))..(((((((((….)))..))))))(((((((((.((…..)).))))))))).(((……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table