Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048970 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA048970
Gene: HERPUD1
MFE: -38.148
ENS: 0.913
Length: 100.
Predicted Ligands:
glycine - 6/20
TPP - 5/20
SAM - 5/20
 RS: URS0000C45BD2_191292
MFE: -30.620
Ligand: TPP
Species: Rhodococcus aetherivorans TPP riboswitch (THI element)
 RS: URS00001EFEA8_1793963
MFE: -24.691
Ligand: SAM
Species: Bacillus nakamurai SAM riboswitch (S box leader)
 RS: URS0000ABD128_720555
MFE: -24.591
Ligand: SAM
Species: Bacillus atrophaeus 1942 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048970 URS0000C45BD2_191292 URS00001EFEA8_1793963 URS0000ABD128_720555
Length 100. 100. 100. 100.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.913 - - -
MFE -38.148 -30.620 -24.691 -24.591
Ligands - TPP SAM SAM
Gene HERPUD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.002 9. 9.
Length SE - 0. 0. 0.
Lev Distance - 25. 24. 24.
UBS 6. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 1. 1. 1.
H 4. 4. 4. 4.
BL 0. 1. 1. 1.
BR 1. 2. 3. 3.
UN 0.120 0.080 0.140 0.140

Sequences

Field Description
UTR seq + 25 aaugggcggcagccacagagcguucuguccgcagagccgggcgcggggcuucuauaaaaggcgcccgaagcggggATGGAGTCCGAGACCGAACCCGAGC
UTR dot + 25 ..(((((….))).))….((((((….))))))(((((((…………….)))))))…((((..(((………)))..))))…
RS 1 seq UCCGUAGACACGGGGUGCUCCGCACACGAGCGGGAGCUGAGAUCACACCCGUCGAACCUGAUCAGGUAAUGCUGACGAAGGGAUGUCACGGCAUGACCAU
RS 1 dot (((((….)))))..(((((((……)))).)))…(((((………….))))).(((.((((((((……..))))..)))).)))..
RS 2 seq UUCUUAUCAAGAGCAGGCAGAGGGACGAGCCCGAUGAAGCCCGGCAACCGACUGAUAAAGCACGGUGCUAAUUCUUGCAGCAGGAGCUGAGAGAUAAGAU
RS 2 dot (((((…)))))….((..(((…..)))..)).((((((((…………..)).))).)))…((((.((((….)))).))))……
RS 3 seq UUCUUAUCAAGAGCAGGCAGAGGGACAAGCCCGAUGAAGCCCGGCAACCGACUUGUAAAGCACGGUGCUAAUUCUUGCAGCUAGCGCUGAGAGAUAAGAU
RS 3 dot (((((…)))))….((..(((…..)))..)).((((((((…………..)).))).)))…((((.((((….)))).))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table