Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048971-1 Similarity: 0.963 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA048971-1
Gene: HERPUD1_0
MFE: -48.867
ENS: 0.896
Length: 136.
Predicted Ligands:
cobalamin - 5/20
FMN - 5/20
TPP - 3/20
 RS: URS0000DA947B_4432
MFE: -42.910
Ligand: TPP
Species: Nelumbo nucifera TPP riboswitch (THI element)
 RS: URS0002312FA1_1352936
MFE: -57.065
Ligand: cobalamin
Species: Streptomyces roseochromogenus subsp. oscitans DS 12.976 Cobalamin riboswitch
 RS: URS0000C7F417_218284
MFE: -37.440
Ligand: FMN
Species: Bacillus vietnamensis FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048971-1 URS0000DA947B_4432 URS0002312FA1_1352936 URS0000C7F417_218284
Length 136. 135. 135. 135.
Similarity - 0.963 0.961 0.961
Ensemble Norm 0.896 - - -
MFE -48.867 -42.910 -57.065 -37.440
Ligands - TPP cobalamin FMN
Gene HERPUD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.003 7.016 1.002
Length SE - 1. 1. 1.
Lev Distance - 43. 47. 51.
UBS 12. 13. 14. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 2.
ILR 1. 1. 0. 1.
H 3. 3. 3. 3.
BL 7. 4. 6. 6.
BR 6. 6. 6. 6.
UN 0.154 0.096 0.030 0.111

Sequences

Field Description
UTR seq + 25 agauugcgggcggcugagacgccgccugccuggcaccuaggagcgcagcggagccccgacaccgccgccgccgccauggaguccgagaccgaacccgagcccgucacgcucATGGAGTCCGAGACCGAACCCGAGC
UTR dot + 25 …..(((((((((……))))))))).((((…..((.(.((.((((.(……).)))).))).))))))((((.((((.((.((….((….))…)).)).)))).))))……………
RS 1 seq AAAACGCACCGGGGGUGCCUGUGCCUGCUUCAGUCCUGGCCUUUUUUUGCUGGGAAAUGGGCAGGGCUGGCUGAGAAAGUCCCUUCGAACCUGAACAGGAUAAUGCCUGCGUAGGGAGUGUGCAUUUCCGUUUCU
RS 1 dot …..(((.((((….)))))))(.((..((((((((.((((((((….)))))).)).)))))))))).).((((((.((((….((((..((((……))))..))))))).).)).))))…….
RS 2 seq CGCGUCGCGCGGUACGGUCGAUCCGAUAUCGACGACGGCGACACGGAAGCCGGUGGGAAUCCGGCACGGUCGCGCCACUGUAUGAGGGACCCCCAGGGGCUCGCGAGUCAGACCCGUGGCCGUCGUCAUGUGCAC
RS 2 dot ..(((((..((((((((…..))).))))).)))))(((((.((…(((((…….))))).)))))))((((.((.((((.((….(((.(((.((……..))))).))))).)))))))).))..
RS 3 seq AUUCGUCUUCGGGGCAGGGUGAAAUUCCCUACCGGCGGUGAUGAAACCAUGUGUUUCUAAGCCCGCGAGCCUUUUGGGGCAGGAUUUGGUGCGAUUCCAAAGCCGACAGUAUAGUCUGGAUGGGAGAAGAUGAAG
RS 3 dot .((((((.(((.((.((((…….)))).))..))).))))))((((.((.((…..((((.(((…..))))))))).)).))))….(((((…(((((……))).)).)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table