Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA048995 Similarity: 0.938 Similarity: 0.937 Similarity: 0.932
UTR: 5HSAA048995
Gene: HEXA
MFE: -99.514
ENS: 0.746
Length: 232.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231523B_1736436
MFE: -99.360
Ligand: cobalamin
Species: Afipia sp. Root123D2 Cobalamin riboswitch
 RS: URS00023158FC_359391
MFE: -82.358
Ligand: cobalamin
Species: Brucella melitensis biovar Abortus 2308 Cobalamin riboswitch
 RS: URS00023148A0_396595
MFE: -116.153
Ligand: cobalamin
Species: Thioalkalivibrio sp. K90mix Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA048995 URS000231523B_1736436 URS00023158FC_359391 URS00023148A0_396595
Length 232. 231. 232. 234.
Similarity - 0.938 0.937 0.932
Ensemble Norm 0.746 - - -
MFE -99.514 -99.360 -82.358 -116.153
Ligands - cobalamin cobalamin cobalamin
Gene HEXA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7.001 2.002
Length SE - 1. 0. 4.
Lev Distance - 78. 81. 83.
UBS 15. 16. 15. 15.
BS 0. 0. 1. 0.
ILL 3. 4. 3. 3.
ILR 2. 4. 4. 3.
H 7. 7. 8. 7.
BL 3. 3. 3. 4.
BR 3. 4. 2. 3.
UN 0.073 0.078 0.099 0.120

Sequences

Field Description
UTR seq + 25 aguugccgacgcccggcacaauccgcugcacguagcaggagccucagguccaggccggaagugaaagggcaggguguggguccuccuggggucgcaggcgcagagccgccucuggucacgugauucgccgauaagucacgggggcgccgcucaccugaccagggucucacguggccagcccccuccgagaggggagaccagcgggccATGACAAGCTCCAGGCTTTGGTTTT
UTR dot + 25 …(((((…..)))))…….((((…..))))..((((((((((((.(((…………….))).))))….))))))))…(((((……)))))((((((((((((…(((…..((((.((((((…)))).))))))…))).)))))))))))).((((((…))))))(((((((..((((.((……..))))))))))))).
RS 1 seq GAUUGCCGCUACGGCACAGGUGCCGGCGUGAGCCGGCUAAUAGGGAAUUCGGUGCCGCUGCGAUCAGCGCCGUGCAUUUUGCAUAGAUGAUCGAUCGCAGCAAUUCCGAAGCUGCCCCCGCAACUGUCAGCGGUGAGUCGUUGUCCACGAUGCCACUGAGCGAAAGCUCGGGAAGGCGGGCAACGGCGGCGAUCCGCGAGCCAGGAGACCUGCCUGUACCGGUCAUCCUUC
RS 1 dot …(((((…)))))…..((((((….))))))…..(((..(((((….(((((((((..(((.(((((…))))).).))…)))))))))….)))))….)))((((……..))))…((((((((((…..(((.((((((….))))))…)))))))))))))(((………)))((((((((.(……).)))).))))..
RS 2 seq CCGUAAUACCGUCAUGACGGUUCCCCGACCGAGAGCGAAGGGGAUUAAUAGGGAACACGGUGAGGACGACCCAUCAAGGGGCCGAGACCGUGGCUGCCCCCGCAACUGUAAGCGGAUUGCCGUUCAUCCUCGUGACGCCGAAAGCGUCAUGCCACUGUGCCCACGGCACGGGAAGGCAGAUGGACGGCGAUUAUCCGCAAGCCAGGAGACCUGCCGUCUUACGUAGUCCAUU
RS 2 dot …….(((((….)))))(((((..((….).)..)))))……(((..((((((…..((.(((……))).))..))))))….)))((((……..))))(((((((((((((..((((((((…..))))))))((.(((((((…)))))))…))..)))))))))))))..(((……..)))((.((((……..))))))….
RS 3 seq ACGGUUCGCCCCUCUCUAGGUGCCCCGGCGCUCAGCCGCCGGGGAUAAUCGGGAAGCCGGUGCGCGAAUCGACAUUCGCAAGGCCGGCACUGCCCCCGCAACGGUAGGCGGAGACGGGCGGAUCCAAUGCCACUGCGGCGCAUCCCCGGGAUGCCCGCGGGAAGGCGAUCCGCCCUGGAUGCAUCGCGCAUCCACUUCGCGAGUCCGGAGACCGGCCUGGACGACACCCGACGC
RS 3 dot ……((((……..))))((((((((……))))))))……(((..((((((..((((((….))))))…))))))….)))((((……..))))….(((((((((….(((.((((((.((((((…))))))))))))…))))))))))))(((((((…..)))))))..((((.((.((((…)))).)).).)))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table