Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049005 Similarity: 0.965 Similarity: 0.964 Similarity: 0.962
UTR: 5HSAA049005
Gene: HEXB
MFE: -61.503
ENS: 0.847
Length: 140.
Predicted Ligands:
cobalamin - 10/20
SAM - 7/20
lysine - 1/20
RS: URS0002315D4D_1822263
MFE: -32.538
Ligand: cobalamin
Species: Thalassolituus sp. HI0120 Cobalamin riboswitch
RS: URS0000AB9B86_469371
MFE: -65.310
Ligand: SAM
Species: Thermobispora bispora DSM 43833 SAM riboswitch (S box leader)
RS: URS0002322D78_1909395
MFE: -53.997
Ligand: cobalamin
Species: Nonomuraea sp. ATCC 55076 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049005 URS0002315D4D_1822263 URS0000AB9B86_469371 URS0002322D78_1909395
Length 140. 141. 140. 138.
Similarity - 0.965 0.964 0.962
Ensemble Norm 0.847 - - -
MFE -61.503 -32.538 -65.310 -53.997
Ligands - cobalamin SAM cobalamin
Gene HEXB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 9. 3.002
Length SE - 1. 0. 4.
Lev Distance - 40. 45. 44.
UBS 10. 10. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 4. 4. 3.
ILR 3. 5. 3. 4.
H 3. 1. 3. 2.
BL 3. 3. 1. 3.
BR 2. 3. 2. 2.
UN 0.093 0.128 0. 0.051

Sequences

Field Description
UTR seq + 25 agucaucugacucggugacucacccgcggccgcgcuuccucugauccgggccgggcgggaagucgggucccgaggcuccggcucggcagaccgggcggaaagcagccgagcggccATGGCTTTTAATAAGTTTAATGTTC
UTR dot + 25 (((((((……)))))))…(((.((((((((((..((((.((((((((((((.(((..((((…))))…))).)))))))…)))))))))))))……)))))).)))(((…..)))……….
RS 1 seq GUGUGUGUGACUACCGCCUGUUCGGGUACUGAAAUAUCGAAGCUGUGUGGAACACCGGUGAAAUUCCGGGGCUGUACCCGCAACUGUAACAGCAGAGCUUUUCUGUGCUGAAGCCAGAUACACAAACGUCUCAGAUUACUC
RS 1 dot ((((((.((……….(((..(((((.((((..((…(((((((((.(((((((…….))))…)))..))))…….))))).))…)))).)))))..))))).))))))………………
RS 2 seq CGCUCAUCAAGAGGGGUGGAGGGACCGGCCCUGUGAAGCCCCGGCAACCCUCCCGGUGACUGUGCUCGUAUCCGCGAGGCCGGCCGGGACAGGUGCCAAUUCCGGCUCCCGGCCAAGGUGGUCGGGAGUGAAGAUGAGGG
RS 2 dot (((((……..)))))..((((..((((((((…..((((((…((((.(((..((…….))..))).))))…))))))))))).)))..)))).(((((((((((…)))))))))))………..
RS 3 seq AACCGGAUAGAAGGAUACGUUCCGGUAGAUUUCACGGUUGUCCAAGGGAAAUCCGGUGAGAUGCCGGUGCGGACGCGCCACUGUAUCCGGGACCCAGAUCCCGGGAGCCAGGUCGCUUGGCGGCCGUGACCUCGCUGU
RS 3 dot .((((((………….)))))).((..(((((((((.(((((.((..(((((.((..(((((((((((……..))))).))))….))..)))))))…….)).))))))))))))))..))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table