Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049035 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA049035
Gene: HEYL
MFE: -25.848
ENS: 0.836
Length: 76.
Predicted Ligands:
fluoride - 8/20
Ni/Co - 4/20
SAM - 4/20
 RS: URS0000DA0F3E_1797497
MFE: -31.268
Ligand: homocysteine
Species: Betaproteobacteria bacterium RIFCSPLOWO2_12_FULL_62_58 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C683E1_1736341
MFE: -27.715
Ligand: fluoride
Species: Leifsonia sp. Leaf336 Fluoride riboswitch
 RS: URS0000D68B06_12908
MFE: -19.119
Ligand: Ni/Co
Species: unclassified sequences NiCo riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049035 URS0000DA0F3E_1797497 URS0000C683E1_1736341 URS0000D68B06_12908
Length 76. 76. 75. 75.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.836 - - -
MFE -25.848 -31.268 -27.715 -19.119
Ligands - homocysteine fluoride Ni/Co
Gene HEYL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 7.003 3.001
Length SE - 0. 1. 1.
Lev Distance - 22. 21. 23.
UBS 6. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 1. 0. 0. 1.
H 4. 3. 3. 3.
BL 1. 0. 1. 1.
BR 1. 3. 2. 1.
UN 0.066 0.132 0.120 0.040

Sequences

Field Description
UTR seq + 25 ccgacugggagccuuagccgcggggcugagaccaggcagccugcguucgccATGAAGCGACCCAAGGAGCCGAGCG
UTR dot + 25 ((…..))…(((((((….)))))))..((((…))))((((((((.((……..)).))…))))))
RS 1 seq GCCCCCGAGGAGCGUUGCAACGGGCCAUACGCGCCCGCCAGGCUCGGGGUGUCAACCGCAACGGCGCUCACGAGCU
RS 1 dot ((((….)).))…….((((((….).)))))…(((((((((((((………))))))).))))))
RS 2 seq UGAUCCAGCGGCGAUGGAUCUCGCCGGGGCGUGAACGCCCGAACCGCGACGGUCGCUGAUAGUUCCUGCGCUUCA
RS 2 dot ……..((((((……))))))(((((….)))))(((.((((..((..(((…))).)))))).))).
RS 3 seq ACAGUACAAGCUGAUCAGGCCGUAAAACCGGCCGGGCCUUACGACAGCAGAAUAUCCUACAUCUGCGGGACAGGA
RS 3 dot .((((….)))).((.(((((……))))).))(((…….(((((……….)))))…..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table