Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049101 Similarity: 0.965 Similarity: 0.963 Similarity: 0.962
UTR: 5HSAA049101
Gene: HHAT
MFE: -43.489
ENS: 0.939
Length: 132.
Predicted Ligands:
cobalamin - 7/20
TPP - 4/20
methionine - 3/20
 RS: URS0000D9777C_1805088
MFE: -56.234
Ligand: zmp-ztp
Species: Comamonadaceae bacterium CG1_02_60_18 ZMP/ZTP riboswitch
 RS: URS0000DB5BFB_1798309
MFE: -58.710
Ligand: cobalamin
Species: Gemmatimonadetes bacterium GWC2_71_10 Cobalamin riboswitch
 RS: URS0000C6DA82_652017
MFE: -58.676
Ligand: methionine
Species: Nesterenkonia sp. AN1 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049101 URS0000D9777C_1805088 URS0000DB5BFB_1798309 URS0000C6DA82_652017
Length 132. 132. 132. 134.
Similarity - 0.965 0.963 0.962
Ensemble Norm 0.939 - - -
MFE -43.489 -56.234 -58.710 -58.676
Ligands - zmp-ztp cobalamin methionine
Gene HHAT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.013 10.001 6.002
Length SE - 0. 0. 4.
Lev Distance - 47. 45. 44.
UBS 10. 11. 11. 10.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 1.
ILR 1. 2. 1. 1.
H 5. 5. 5. 5.
BL 5. 5. 3. 3.
BR 2. 2. 4. 3.
UN 0.144 0.030 0.106 0.097

Sequences

Field Description
UTR seq + 25 uuucgccuacaaaacguagguggggaccacugguguuggaaugacggcccaccucgaguuucagaaacucucagcguaggcaucgggaaccuucgugccaaggagccATGCTGCCCCGATGGGAACTGGCAC
UTR dot + 25 ((((((((((…..))))))))))…..(((.((((……)))))))….((((((…)))))).((((((.(((.((.((.((….)).))..)).)))))))))(((….)))………
RS 1 seq UGCUCCGCACGCGACUGGCGAUAGGCAACCCCGACUGCAAAACCGGGGGGUGCUGAAGUGGGAGCACCACGGGGGAGCGUGCCGCAUAGCCUGUUUGGGCUGCGCGAUCAGCCGUUCGCCUGGGCAGCCCUG
RS 1 dot ((((.(((.(……))))…)))).(((((……….)))))((((((……..)))))).((((.(((((.(((((.((((((….)))))).)))….))))))).))))((….))..
RS 2 seq GGAAGCCGGUGGAACUCCGGCACGGCCCCGCCACUGUAACGGGUUGGGAGCAGUUGCUCCCCACGGCGCCUCACAUGCCACUGGCCUCAGGCCGGGAAGGCGAGGCGGCCGCGACACCCGAAGUCAGGAGAC
RS 2 dot ….((((((.(…..).)).))))((((………))))..((((((….))))))(.(((((((((….(((.((((((…))))))…))))))))).))).)….((…….))….
RS 3 seq GGUCAAGAGUGCCAGCGCAAAACCCCGGUUUGCUGGCCGGCAACCCUCCAGUUCGCGGUGGGGUGCCCCGGGUGACGACCUGGUUGCGGCAGUCCCGGAGAAGAUCCAAGGACUGACCGUGGCAAGCGCGGGCC
RS 3 dot ……….(((((((…(((….)))))))))).((((.(((.((…….)).))).))))((((((….))))))..((((((((((.(((…..)))..)))))).))))(((……..)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table