Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049207 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA049207
Gene: HIP1R
MFE: -28.177
ENS: 0.846
Length: 84.
Predicted Ligands:
zmp-ztp - 10/20
GMP - 6/20
TPP - 4/20
 RS: URS00023156B1_1736553
MFE: -36.235
Ligand: zmp-ztp
Species: Microbacterium sp. Root53 ZMP/ZTP riboswitch
 RS: URS0000DA9A99_1660128
MFE: -29.637
Ligand: zmp-ztp
Species: Phenylobacterium sp. SCN 69-14 ZMP/ZTP riboswitch
 RS: URS00023325DA_53376
MFE: -26.081
Ligand: TPP
Species: Mycobacterium heidelbergense TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049207 URS00023156B1_1736553 URS0000DA9A99_1660128 URS00023325DA_53376
Length 84. 84. 84. 85.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.846 - - -
MFE -28.177 -36.235 -29.637 -26.081
Ligands - zmp-ztp zmp-ztp TPP
Gene HIP1R - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.001 4.007 7.014
Length SE - 0. 0. 1.
Lev Distance - 19. 22. 20.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 4. 2. 3. 2.
H 1. 2. 1. 1.
BL 5. 4. 4. 4.
BR 4. 5. 3. 5.
UN 0.024 0.048 0.107 0.141

Sequences

Field Description
UTR seq + 25 gaccgugaggcugugagucgcgcggacggagccggacaaaagcgggcggcggcggcaggATGAACAGCATCAAGAACGTGCCGG
UTR dot + 25 ..((((((.(((((..(((..((.(.((..(((.(.(….)).)))..)).).))..)))..))))).)))………)))
RS 1 seq UGGGCGUGUCGCGACUGGCGUUGAGGUGGUGCACCACCGGGAAGCGACCGAGACGGCAUUCGACCGCACGCCUGGGCCGAUGCG
RS 1 dot .((((((((.((((.((.((((..(((.((…((….))..)).)))..)))).)).))).).))))))))..((….)).
RS 2 seq CAGCAUCCGCGUGACUGGCGAAAUCGAGGUGGGCGACCACCGGGGAGCGCGGAUCUCAUAGCGCCGCUCGCCUGGGCAAUUUCC
RS 2 dot ..((..(((.((((.(((((..((.((((((.((..((….))..)).)..)))))))..))))).)))).)))))…….
RS 3 seq CACGGGAGUCCCGGGAGCGGGGUCUGAGAGUGGGCGCGCCUGUCCUUACCGUCGAACCUGAUCCGGAUCAUGCCGGCGAAGGGAG
RS 3 dot ..(((.((..(((((..((((.((.((..(((((.((….)).)))))..)))).)))).)))))..).).)))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table