Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049231 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA049231
Gene: HIPK3
MFE: -23.201
ENS: 0.957
Length: 108.
Predicted Ligands:
SAM - 19/20
TPP - 1/20

 RS: URS0000C51EA0_1450761
MFE: -26.760
Ligand: SAM
Species: Aneurinibacillus sp. XH2 SAM riboswitch (S box leader)
 RS: URS0000D86B48_54914
MFE: -30.366
Ligand: SAM
Species: Brevibacillus parabrevis SAM riboswitch (S box leader)
 RS: URS0000D84B69_1121919
MFE: -31.747
Ligand: SAM
Species: Geosporobacter subterraneus DSM 17957 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049231 URS0000C51EA0_1450761 URS0000D86B48_54914 URS0000D84B69_1121919
Length 108. 108. 109. 107.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.957 - - -
MFE -23.201 -26.760 -30.366 -31.747
Ligands - SAM SAM SAM
Gene HIPK3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 8.001 6.001
Length SE - 0. 1. 1.
Lev Distance - 28. 26. 27.
UBS 6. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 2. 2. 1. 2.
H 3. 4. 4. 3.
BL 2. 2. 3. 3.
BR 0. 0. 1. 1.
UN 0.167 0.194 0.193 0.140

Sequences

Field Description
UTR seq + 25 gauuuccuaaucuccaggaggaaagaaacuagucuuugggaguuaaaccgacuaauuuaacggagaauuaccaauguggagguATGGCCTCACAAGTCTTGGTCTACC
UTR dot + 25 ..((((((……….))))))……..((((((.((((((…….))))))..))))))…((((((((.(((((…))))))))….)))))…..
RS 1 seq UUCUUAUCAAGAGUGGUGGAGGGAUUAGGCCCAAUGAAACCCAGCAACCGGCGGAUGCAUUCGCAAGGUGCUACAUCCUACAGGACAUUUUGUUCUGAAAGAUAAGAA
RS 1 dot …((((((….)))))).(((……)))……….(((.(((.(((((….)))))..))))))..(((…(((((((…)))))))…)))…..
RS 2 seq UUUUCAUCAAGAGCGGUGGAGGGACAGGCCCUAUGAAACCCGGCAACCAGCAAGCGAGUCUUGCGCGGUGCUAAUUCCUGCAGAAUCCAUAGAUUCUGAGAGAUGAACG
RS 2 dot ..((((((……))))))(((…..)))……….(((.(((.(((((…..)))))..))))))…((((.(((((((….))))))))).))……
RS 3 seq CUCAUAUCCAGAGAGGUGGAGGGUCUGGCCCUAUGAAACCCGGCAACCGGCUUUUUAUUAAGCAGCGGUGCCAAUUCCUGCAGUAUGAAAAUACUGAGAGAUAUGAG
RS 3 dot .(((((.(((((………..)))))…)))))…..(((.((((((((……))))..)))))))…((((.((((((….)))))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table