Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049530 Similarity: 0.962 Similarity: 0.960 Similarity: 0.958
UTR: 5HSAA049530
Gene: HMBOX1
MFE: -34.831
ENS: 0.792
Length: 138.
Predicted Ligands:
FMN - 10/20
cobalamin - 4/20
TPP - 3/20
 RS: URS0000D9285D_1970471
MFE: -30.866
Ligand: FMN
Species: Gilliamella sp. N-G2 FMN riboswitch (RFN element)
 RS: URS0000C5CDF2_1736516
MFE: -58.804
Ligand: FMN
Species: Yonghaparkia sp. Root332 FMN riboswitch (RFN element)
 RS: URS0000C752AB_1837282
MFE: -41.521
Ligand: FMN
Species: Enteractinococcus helveticum FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049530 URS0000D9285D_1970471 URS0000C5CDF2_1736516 URS0000C752AB_1837282
Length 138. 139. 137. 137.
Similarity - 0.962 0.960 0.958
Ensemble Norm 0.792 - - -
MFE -34.831 -30.866 -58.804 -41.521
Ligands - FMN FMN FMN
Gene HMBOX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.014 8.038 15.006
Length SE - 1. 1. 1.
Lev Distance - 48. 50. 50.
UBS 7. 8. 8. 10.
BS 0. 0. 1. 0.
ILL 2. 3. 2. 3.
ILR 0. 1. 1. 2.
H 3. 3. 3. 4.
BL 2. 2. 4. 2.
BR 2. 3. 3. 2.
UN 0.246 0.129 0.051 0.168

Sequences

Field Description
UTR seq + 25 aauuuuucucaggggaggcaggaacuacaacucccagggacgcccggcggcagcagaaugguagauaacgcagaucaucucuggaaaggauauugauccgccucauguaaaguATGCTTAGTTCCTTTCCAGTGGTTT
UTR dot + 25 ……((((..(((((………….))))).)))).(((….)))…………………….(((.((((((((((.(((((…((…………..))))))))))))))))).)))..
RS 1 seq CAAAAUUCUCAGGGCGGGGCGCAAUUCCCCACCGGUGGUAUAGCCCACGAGCGCUUAGUAAAAUUCUAUUUUAUUAAGGACAGCAGAUUUGGUGAGAUUCCAAAGCCGACAGUUAAAGUCUGGAUGAAAGAGAGUAGCU
RS 1 dot …………((.((((…….)))).)).((((……))))….(((…….(((((.(((((((..((((…….(((((………..)))))……..)))).))))))).)))))))).
RS 2 seq AACGCACUUCGGGGUCGGUGAAAGUCCGAGCCGGCGGUCAUAGUCCGCGACCCGUGGUCGAGCUCUCGGGCUCGGCACCGGUUGAGCUGGUGGAACUCCAGCACCGACGGUGAGAGUCCGGAUGGGAGAAGUGCGGU
RS 2 dot ..((((((((.((.((((…….)))).)).((((…….))))..(((((……….((((((((..((((.((((.(((((…….)))))..)))))))).))))))))))))).))))))))..
RS 3 seq CCUGUGUUCCGGGGUCGGUGAGAAUCCGAACCGGCGGUGAAAGUCCGCGACCCCCGCGCCUGCGGGGCUGAUCCAGUGAAAUUCUGGUACCGACGGUGAUAAGCGAAAUGCUUUAGUCCGGAUGAGAGGAACGCGCC
RS 3 dot ………(((..((((…….)))).)))((((…….))))…((((((….))))))……..(((…((((.((.(((…..(((((((…..))))..)))))))).))))…)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table