Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049620 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA049620
Gene: HMGB1
MFE: -43.746
ENS: 0.997
Length: 135.
Predicted Ligands:
molybdenum - 15/20
TPP - 2/20
FMN - 2/20
 RS: URS0000C851D4_1122185
MFE: -51.840
Ligand: molybdenum
Species: Lysobacter concretionis Ko07 = DSM 16239 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C49912_1504156
MFE: -43.337
Ligand: molybdenum
Species: Microbacterium sp. SUBG005 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D8593D_83655
MFE: -44.623
Ligand: molybdenum
Species: Leclercia adecarboxylata Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049620 URS0000C851D4_1122185 URS0000C49912_1504156 URS0000D8593D_83655
Length 135. 135. 135. 135.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.997 - - -
MFE -43.746 -51.840 -43.337 -44.623
Ligands - molybdenum molybdenum molybdenum
Gene HMGB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 3.002 9.002
Length SE - 0. 0. 0.
Lev Distance - 37. 41. 39.
UBS 7. 9. 8. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 3. 2. 2. 1.
H 3. 4. 4. 5.
BL 1. 3. 1. 1.
BR 1. 2. 1. 0.
UN 0.185 0.215 0.230 0.230

Sequences

Field Description
UTR seq + 25 gauuacgcugacgaaagagaccugcuugcgcgucgcuguuccgugguccgcgcgagcguggucgggagccgcugguuccuggggugacccgcggagaaaaauaacuaaacATGGGCAAAGGAGATCCTAAGAAGC
UTR dot + 25 ………………((((((((((((((((((……))))..)))))))))).)))).((((((…))))))((((((..((.((………………….))…))..))))))……
RS 1 seq CGUCCCGCGCAACUCCCAGCCGCGUCGCCUGUGUCCGGUGGAUAUGGCAGCGCGGCCGUGGUCUUCGUGACCACCGGGCCGGUCUGGAAACGCACCGGUCUCCCGUAUUUGGAAAGGAGUCACAUGAAAAACCUC
RS 1 dot ………………(((((((.(((.((((((…))))))))).))))))).((((((…..))))))(((((((((.((….)).)))))…))))………(((..((….))….))).
RS 2 seq UUUGAAAACAUACACUCUAGCCCUGGYGCCUGUGUCGARAGAUAUGGCGCCCUGGCCGUGGCAACUAUGCCACCAGGGUACAGAAAGAAAUGACUGUGCCUCCCGUAUCUGGAAAGGUGUACAUGGCUUCACAAC
RS 2 dot ……………….(((..((((((.(((((….)))))))))))..))).((((((….))))))..((((((((……….))))))).)((((((((….))))….))))………
RS 3 seq AUCGAAAACAUACACUCUAGCCUUUGCGCCUGUGUCGAAAGAUAUGGUGCUCUGGCCGUGGCGGUUUCGCCACCAGGGUACAGAAAGAAAUGACUGUGCCUCCCGUAUCAGGAAAGGUGUACAUGGCAUCACAAC
RS 3 dot ……………….(((…(((((.(((((….))))))))))…))).((((((….))))))..((((((((……….)))))))).((……))…(((((…..)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table