Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049629 Similarity: 0.937 Similarity: 0.934 Similarity: 0.934
UTR: 5HSAA049629
Gene: HMGB1_0
MFE: -55.963
ENS: 0.957
Length: 206.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0002319424_1703345
MFE: -65.357
Ligand: cobalamin
Species: Niastella vici Cobalamin riboswitch
 RS: URS000232F084_1895836
MFE: -62.116
Ligand: cobalamin
Species: Sphingobacteriales bacterium 41-5 Cobalamin riboswitch
 RS: URS000231B5CA_362418
MFE: -38.707
Ligand: cobalamin
Species: Flavobacterium reichenbachii Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049629 URS0002319424_1703345 URS000232F084_1895836 URS000231B5CA_362418
Length 206. 206. 208. 207.
Similarity - 0.937 0.934 0.934
Ensemble Norm 0.957 - - -
MFE -55.963 -65.357 -62.116 -38.707
Ligands - cobalamin cobalamin cobalamin
Gene HMGB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.004 11.004 14.004
Length SE - 0. 4. 1.
Lev Distance - 82. 77. 81.
UBS 10. 12. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 3.
ILR 1. 1. 2. 2.
H 6. 6. 6. 5.
BL 3. 4. 2. 3.
BR 3. 2. 0. 5.
UN 0.316 0.252 0.255 0.256

Sequences

Field Description
UTR seq + 25 agucagaacagaaauacaucucagggccaaaccgauaggaaacgaggcugccucgcgguggcaccgccaccccccaaccggguuccgagcaccggagcuggcugcugcucccucuuuggagcaaaguuuuaugcaaagaggguguuuuuugaaacuuucggugcacgaaaaauaacuaaacATGGGCAAAGGAGATCCTAAGAAGC
UTR dot + 25 …………………..((……))………(((((…))))).((((((…))))))(((…..)))…((.(((((((((………((.(((((((((.(………..).))))))))).))……….))))))))).))………………….(((….)))…….
RS 1 seq UACCUUGCGCCCGUUAUUGGUCCCCGGCAUUGCGCCGGGGUUAAAAGGGAACCCGGUGAAAGUCCGGGGCUGUCCCGCAGCUGUAAAAGGCUUCACGUAAGUGAAACAGCUUAUUCUACAAUGCCACUGUUCCAAUUGUACCGGAAACGGGAAGGCAAAUAAGCUGGGCCCUGAGCCAGAAGACCUGCCAUAACAACGAAUUCGCG
RS 1 dot ……….((.((.((((.(((((((…..))))))))))))).))..(((((…….)))))(((((…)))))……….(((((….))))).(((((((((……((((.(((((((………)))).)))…)))))))))))))(((…..)))………………………..
RS 2 seq UACAUUUGCAACCGUUCAGGUCCCGCCACGGCGGGAUAAUAGGGAAGCCGGUGAAAGGCCGGCGCUAUCCCCGUAGCUGUAAUGCCCACCCAAACCUCCCGAAGGGGGGUCUUUGAAAACGUUUUACUAAAUGCCACUUUCUUAAUUCAGAAGGGAAGGGUAGUAAAACGGGCAAAGCCAGAAGACCUGCCUGAAUUCCGAUAACUAU
RS 2 dot ……………….((((((……))))))….((((.((((((…..))))))….))))….((……))…..((((((((((…)))))))..)))….(((((((((….(((.(((((((……..)))))))))))))))))))((((………….))))……………..
RS 3 seq UCUUUGCACGAAAUUUAAGGUUGGGUUAUAUUUUUAUAUAACACAUUAAAAGGGAAUCAAGUAAAAACUUGAGCUGUACCCGCAACUGUAAACUUAGUUCUGAAAAGAAUGCUUGUUGUUAGCUGCAAAGCCACUGUUCGCCCCUGCGAUUGGGAAGGUAAACAACAAGACGUAAGCCAGGAGACCUGCCUUUAUAACAAAUAUCGA
RS 3 dot …………………((.(((((((….))))))).))……(((..((((((….))))))……)))..(((((……)))))………((((((((((((.(((……(((….((((….)))).)))…))).))))))))).)))(((.((((…)))).)))……………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table