Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049630 Similarity: 0.961 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA049630
Gene: HMGB1_1
MFE: -51.719
ENS: 0.980
Length: 167.
Predicted Ligands:
Mg2+ - 15/20
FMN - 3/20
lysine - 2/20
 RS: URS0000C1A5D3_1679170
MFE: -49.352
Ligand: Mg2+
Species: Bacillus sp. FJAT-27997 M-box riboswitch (ykoK leader)
 RS: URS0000D821A9_85682
MFE: -44.107
Ligand: Mg2+
Species: Bacillus arseniciselenatis M-box riboswitch (ykoK leader)
 RS: URS0000D9DBA1_199441
MFE: -44.917
Ligand: Mg2+
Species: Bacillus krulwichiae M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049630 URS0000C1A5D3_1679170 URS0000D821A9_85682 URS0000D9DBA1_199441
Length 167. 168. 167. 167.
Similarity - 0.961 0.961 0.961
Ensemble Norm 0.980 - - -
MFE -51.719 -49.352 -44.107 -44.917
Ligands - Mg2+ Mg2+ Mg2+
Gene HMGB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3. 3.
Length SE - 1. 0. 0.
Lev Distance - 49. 51. 51.
UBS 10. 9. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 2. 2. 2.
H 6. 6. 6. 6.
BL 3. 2. 3. 3.
BR 2. 1. 3. 3.
UN 0.210 0.238 0.198 0.198

Sequences

Field Description
UTR seq + 25 cgauaggaaacgaggcugccucgcgguggcaccgccaccccccaaccggguuccgagcaccggagcuggcugcugcucccucuuuggagcaaaguuuuaugcaaagaggguguuuuuugaaacuuucgaaaaauaacuaaacATGGGCAAAGGAGATCCTAAGAAGC
UTR dot + 25 ……….(((((…))))).((((((…))))))(..((.((.(((((((…..))))))))).))..)..(((((((((.(………..).)))))))))(((((((((((…)))))))))))……………(((….)))…….
RS 1 seq AAAUAUCCUCGUUAGGUGAGGCUCCUGUGUUGGAGAUAUGCUACUGCCCAAAAAUGUCGAAAGACGCCAAUGGGUCAACAGAAACCAUCGACAUAAGGUGGUUUUUAAUGUAGCUGGGCUUUUGCCCUAUGCCACACAGUGCUAAAGCUCUACGAAUGGAGGAACAGA
RS 1 dot ……(((((…..)))))((((……))))……….(((((….((((….))))….)))))….((((((((((…….))))))))))..(((.((.((((….))))…)).)))………..(((((….)))))…….
RS 2 seq UAAAUACCUCGUUAGGUGAGGCUCCUGUGCUGGAGAUACGCUGCUGCCCAAAAAUGUCCAAAGACGCCAAUGGGUCAACAGGAACUAUCGAAUUAAGGUGGUUCUUAAUGUAGCUGGAUUUGAUCCUAUGCCGCACAGUGCUAAAGCUCUACGAAUGGAGGAAAAAA
RS 2 dot ……(((((…..)))))((((……))))…..(((.((((((….((((….))))….)))).)).)))((((((((…….))))))))….(((.((.((((…))))…)).)))………..(((((….)))))…….
RS 3 seq AUAGGUCCUCGUUAGGUGAGGCUCCUGUGCUGGAGAUACGCUGCUGCCCAAAAACGUCCAAAGACGCCAAUGGGUCAACAGGAACCAUCGACAUAAGGUGGUUUUUAAUGUAGCUGGAUUUAAUCCUAUGCCGCACAGUGCUAAAGCUCUACGAAUGGAGGAAUGUU
RS 3 dot ……(((((…..)))))((((……))))…..(((.((((((….((((….))))….)))).)).)))((((((((…….))))))))….(((.((.((((…))))…)).)))………..(((((….)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table