Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049741 Similarity: 0.933 Similarity: 0.922 Similarity: 0.922
UTR: 5HSAA049741
Gene: HMGN2
MFE: -76.945
ENS: 0.713
Length: 227.
Predicted Ligands:
cobalamin - 13/20
TPP - 4/20
glucosamine - 1/20
 RS: URS000231CDDF_190650
MFE: -90.756
Ligand: cobalamin
Species: Caulobacter crescentus CB15 Cobalamin riboswitch
 RS: URS000233219D_36818
MFE: -90.512
Ligand: cobalamin
Species: Streptomyces subrutilus Cobalamin riboswitch
 RS: URS0001BFC999_90371
MFE: -78.476
Ligand: TPP
Species: Salmonella enterica subsp. enterica serovar Typhimurium TPP
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049741 URS000231CDDF_190650 URS000233219D_36818 URS0001BFC999_90371
Length 227. 228. 225. 225.
Similarity - 0.933 0.922 0.922
Ensemble Norm 0.713 - - -
MFE -76.945 -90.756 -90.512 -78.476
Ligands - cobalamin cobalamin TPP
Gene HMGN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 14. 29.001
Length SE - 1. 4. 4.
Lev Distance - 81. 91. 83.
UBS 20. 20. 20. 18.
BS 0. 0. 0. 0.
ILL 8. 7. 6. 9.
ILR 7. 5. 6. 9.
H 3. 3. 5. 3.
BL 9. 9. 8. 5.
BR 6. 9. 4. 4.
UN 0.053 0.026 0.071 0.080

Sequences

Field Description
UTR seq + 25 agcugggccaaugaacggcggcgggaggugaaauccgguucuaaccgguccggggcucccagcgcuauaaaaacuuuauaaaccccccggagcccgagcagugugaagaagaggcgagaacgacccccggaccgaccaaagcccgcgcgccgcugcaucccgcguccagcaccuacgucccgcugccgucgccgccgccaccATGCCCAAGAGAAAGGCTGAAGGGG
UTR dot + 25 .(((((((….((.((((((((.(.((.(……(((……((((((((((.((….((((…….((((((..((..(.(((…))).)..))))))))….))))…..)).)))))))))))))….))).).))))))))..))….)))))))………..((.((….)).))(.((..((.(((………)))))..)).)
RS 1 seq GUCUGUUGCCGUUGUCGUGGUCUGCGGACGUUCGCGUCCGGAGCUAAGAGGGAAGUCGGUGAGGGCGUGAAACCCUGAAUCCGGCGCUGCCCCCGCAACUGUGAGCGGCGAGCCGCUGUCCGUUUCGUGUCACUGACGCGCCGAAGCUGGUUCGGGGAUGCGUCGGGAAGGCCAGGGCAGGGGUGACGACCCGUGAGCCAGGAGACCUGCCUCGACAGAUAACGUCCU
RS 1 dot (((.((((((.(((((.((((((.(.(((….((((((.((((((…((…((((((((.(…((((((…((…((((..(((((.(((….))).).)))).))))…)).))))))).))))))))…))…..))))))..))))))))).)..)))))).))))).)))))))))….(((.((((…)))).)))(((…….)))..
RS 2 seq UAGGCUGAGAGCGCAGCUGGUUCGCCCCGUCCGCCAGGCGGGAUGCGUCGUAAGAGGGAACCCGGUGGGAAUCCGGGACUGCCCCGCAGCGGUGAGCGGGAACGACCGCCGUCAUAAGCACUGGAACCGGAACCGGUCCCGGGAAGCGACGGCCAUUAGGUGCCCGCCGGGAGACCGGCAGGCGUGUCCGCGAGUCCGAAGACCUGCCACUGCCCGCAUGCCUGA
RS 2 dot ..(((((……)))))((.(((.(((((.((((..(((((..(((((.(…..(((..((….))..)))).))).)))))))…)))).)))))..)))))((((((….((.((((.((((….)))).))))…))))))))………….((((….))))(((((((((..((.(((.((……))..)))))..))))))))).
RS 3 seq UUAUCUUGUCGGAGUGCUAAUUUUCCACAAAAGCGUUCGUGAUGCGUCAAGGCGGCAAGUCGGUGAAUCUCCAGGAGCUUACAUAAGUAAGUGACUGGAGUGAGCGGACGAAGCCAACAAAGAGGCAGCGCGAAGGAUGACGUGGAAAAGGCUGAGACCGUUAAUUCGGGAUCCGCGGAACCUGAUCAGGUUAAAACCUGCGAAGGGAACAAGAGUAAUUCUGCU
RS 3 dot ……………(((..((((((((…..(.((((((.(((.((..(..(((..(((.((..(.((((((..((((((….))))))..)))))))..)).)))…)))..)…)).))).)))))).)…..))))))))))).((..(((……)))..)).(((((((((…(((((….)))))…)))…………)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table