Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049766 Similarity: 0.979 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA049766
Gene: HMOX1
MFE: -29.122
ENS: 0.819
Length: 105.
Predicted Ligands:
TPP - 13/20
SAM - 4/20
Ni/Co - 1/20
 RS: URS00007D8FDD_1499687
MFE: -33.281
Ligand: SAM
Species: Planococcus massiliensis SAM riboswitch (S box leader)
 RS: URS0000C3A59F_407035
MFE: -26.015
Ligand: Ni/Co
Species: Salinicoccus halodurans SAM riboswitch (S box leader)
 RS: URS0000C47865_1221500
MFE: -23.003
Ligand: SAM
Species: Fictibacillus phosphorivorans SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049766 URS00007D8FDD_1499687 URS0000C3A59F_407035 URS0000C47865_1221500
Length 105. 105. 104. 105.
Similarity - 0.979 0.976 0.976
Ensemble Norm 0.819 - - -
MFE -29.122 -33.281 -26.015 -23.003
Ligands - SAM Ni/Co SAM
Gene HMOX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 11. 7.002
Length SE - 0. 1. 0.
Lev Distance - 26. 26. 30.
UBS 9. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 2.
ILR 3. 2. 2. 3.
H 2. 3. 3. 3.
BL 2. 2. 2. 2.
BR 2. 2. 1. 1.
UN 0.171 0.190 0.173 0.124

Sequences

Field Description
UTR seq + 25 ucaacgccugccuccccucgagcguccucagcgcagccgccgcccgcggagccagcacgaacgagcccagcaccggccggATGGAGCGTCCGCAACCCGACAGCA
UTR dot + 25 …..((((((…..((((..(((.((..(.((..((((…..)))).))))).)))..))))….)))..)))((((((…))))))………….
RS 1 seq UUCUUAUCGAGAGAAGUCGAGGGACUGGCCCUAUGACGCUUCAGCAACCAGCCGAAAGGUCAGGUGCUAAAUCCAGCAGGCAAGCGAUUGCCUGAGAGAUGAAAA
RS 1 dot ……((((……)))).(((.((((((..((((..(((.((…..)).)))..)))))).))))..)))..(((((((….)))))))………..
RS 2 seq UAUUUAUCCAGAGAAGUGGAGGGAUCAGGCCCGAUGAAACUUCAGCAGCGGACUCUGCGGAGUACUGUGCUAAAUCCUGCAGGCAGCGGCUUGAGAGAUGAAAU
RS 2 dot ……((((……))))(((((..(((.((…..(((((.((((……)))))))))..)).)))..))))).(((((….)))))………..
RS 3 seq CUCUUAUCAAGAGUGGUGAAGGGAUCUGGCCCGAUGAAACCCGGCAACCUGCGAUCGUAAGGUGCUAACUCCAGCAGAAUGUUUUUACAUUUUGGAAGAUAAGGU
RS 3 dot ((.((((((….))))))))(((..((((((.((((….(((….)))…))))..)).))))..)))..((((((((….))))))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table