Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA049817 Similarity: 0.995 Similarity: 0.995 Similarity: 0.995
UTR: 5HSAA049817
Gene: HNF4G
MFE: -11.829
ENS: 0.967
Length: 50.
Predicted Ligands:
SAM - 18/20
Ni/Co - 2/20

 RS: URS0000C1E701_1792508
MFE: -15.674
Ligand: SAM
Species: Yangia sp. CCB-MM3 SAM/SAH riboswitch
 RS: URS0000C19C26_766499
MFE: -15.815
Ligand: SAM
Species: Citreicella sp. 357 SAM/SAH riboswitch
 RS: URS0000AB5383_314265
MFE: -15.796
Ligand: SAM
Species: Pelagibaca bermudensis HTCC2601 SAM/SAH riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA049817 URS0000C1E701_1792508 URS0000C19C26_766499 URS0000AB5383_314265
Length 50. 49. 49. 49.
Similarity - 0.995 0.995 0.995
Ensemble Norm 0.967 - - -
MFE -11.829 -15.674 -15.815 -15.796
Ligands - SAM SAM SAM
Gene HNF4G - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 1. 1.
Length SE - 1. 1. 1.
Lev Distance - 5. 5. 5.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 0. 1. 1. 1.
BR 1. 1. 1. 1.
UN 0.140 0.143 0.143 0.143

Sequences

Field Description
UTR seq + 25 gaggguaucagaaccaauacuggacATGAATACCACAGACAACGGTGTCA
UTR dot + 25 …(((((((…(((….)))…))).))))…((((….)))).
RS 1 seq UCCCUGUCACAACGGCUUCCUGGCGUGACAGCUGGUACCUAAUGGAGCG
RS 1 dot …(((((((..(((….)))..)))))))…((.((….)).)).
RS 2 seq UCCUCGUCACAACGGCUUCCUGGCGUGACGACCGGUACCUAAUGGAGCG
RS 2 dot …(((((((..(((….)))..)))))))…((.((….)).)).
RS 3 seq UCCCCGUCACAACGGCUUCCUGGCGUGACGGCUGGUACCCAAUGGAGCA
RS 3 dot …(((((((..(((….)))..)))))))…((.((….)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table