Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050012 Similarity: 0.967 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA050012
Gene: HNRNPH1
MFE: -41.370
ENS: 0.861
Length: 142.
Predicted Ligands:
cobalamin - 15/20
FMN - 4/20
glycine - 1/20
 RS: URS00023187FC_767434
MFE: -37.517
Ligand: cobalamin
Species: Frateuria aurantia DSM 6220 Cobalamin riboswitch
 RS: URS00023210C5_710696
MFE: -58.452
Ligand: cobalamin
Species: Intrasporangium calvum DSM 43043 Cobalamin riboswitch
 RS: URS0002325F07_1955065
MFE: -46.010
Ligand: cobalamin
Species: Streptomyces sp. M41(2017) Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050012 URS00023187FC_767434 URS00023210C5_710696 URS0002325F07_1955065
Length 142. 141. 141. 143.
Similarity - 0.967 0.964 0.964
Ensemble Norm 0.861 - - -
MFE -41.370 -37.517 -58.452 -46.010
Ligands - cobalamin cobalamin cobalamin
Gene HNRNPH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 14.001 3.001
Length SE - 1. 1. 1.
Lev Distance - 41. 40. 46.
UBS 12. 12. 11. 12.
BS 0. 0. 0. 0.
ILL 5. 4. 5. 6.
ILR 4. 3. 2. 4.
H 2. 2. 2. 3.
BL 2. 3. 2. 1.
BR 5. 4. 2. 5.
UN 0.063 0.078 0.035 0.098

Sequences

Field Description
UTR seq + 25 gcagaacucgcacaagggaccuuauuuagguugcgcaggcgcccgcuggccauuucgucuuagccacgcagaagucgcgugucuaguuuguuucgacgccggaccgcguaagagacgATGATGTTGGGCACGGAAGGTGGAG
UTR dot + 25 ……((.((….(.(((((…..))))).))).))((((..((((((((((((((((….((((….(((..(((((………..)))))..))).))))..))))))).)))….))).)))..))))…
RS 1 seq GCAAAUAUGCAAGCACGCAGGUGGCCGCUGGAUGUAUGAUCGGCGAAACAAGCGGGAAACAGGAAACCGGUGGAAAUCCGGUACGGUCGCGCCACUGUUAUCGAGUCAUCGAGAGUCAGACCCUGUUUCCAGUCCGCCAGU
RS 1 dot …..((((((..((.((.((…))))))..))))))…((((……((.(((((((((..((((((((….((((((((((……))))).)))).)))))))…))…..))))))))).)).))))…
RS 2 seq CCGUCUGCCACAGUUCGACUUACCGAUGGGCAAUGGGGCAAGCCGGUGAGACUCCGGCGCUGACCCGCAACCGUGACCCCGGCCGCCGACGACCUCGGCACCGGGACCAGCCGGAAAACCCGUGUCCAUCCGGCUCCCCAU
RS 2 dot …..((((.((..(((……)))))))))((((((..((((((((.(((((((((……………((..(((((..(((((…..))))).)))))..))))))))……..))))).))))))))))))
RS 3 seq UACCCGCCACGCGGUACGGUCGGUCCGAUAACGAUGACGUCAGGACGGAAGCCGGUGGGAAUCCGGCACGGUCGCGCCACUGUGAACGAGACGCUCCAGCACGCUGGACACCUCGCAAGUCAGACCCGUAGACGUCAUCCAGU
RS 3 dot …((((…))))..(((…..)))…..(((((((((…((((..((..(((((..((((((.(((..(((…((…….)).))).)).)…))))))..)).)))..))…..)))).)))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table