Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050023 Similarity: 0.954 Similarity: 0.954 Similarity: 0.954
UTR: 5HSAA050023
Gene: HNRNPH1_0
MFE: -62.380
ENS: 0.970
Length: 172.
Predicted Ligands:
Mn2+ - 6/20
lysine - 4/20
TPP - 3/20
 RS: URS00000DA9CE_28173
MFE: -55.467
Ligand: lysine
Species: Vibrio nigripulchritudo Lysine riboswitch
 RS: URS00002D167F_1238450
MFE: -55.467
Ligand: lysine
Species: Vibrio nigripulchritudo SOn1 Lysine
 RS: URS000232CB4E_1263074
MFE: -42.592
Ligand: cobalamin
Species: Dorea longicatena CAG:42 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050023 URS00000DA9CE_28173 URS00002D167F_1238450 URS000232CB4E_1263074
Length 172. 172. 172. 173.
Similarity - 0.954 0.954 0.954
Ensemble Norm 0.970 - - -
MFE -62.380 -55.467 -55.467 -42.592
Ligands - lysine lysine cobalamin
Gene HNRNPH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 5.001 6.006
Length SE - 0. 0. 1.
Lev Distance - 59. 59. 57.
UBS 12. 13. 13. 14.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 4.
ILR 3. 4. 4. 3.
H 3. 2. 2. 3.
BL 5. 5. 5. 5.
BR 3. 4. 4. 4.
UN 0.105 0.134 0.134 0.179

Sequences

Field Description
UTR seq + 25 acaagggaccuuauuuagguugcgcaggcgcccgcuggccauuucgucuuagccacgcagaagucgcgugucuaggugagucgcgguggguccucgcuugcaguucagcgaccacguuuguuucgacgccggaccgcguaagagacgATGATGTTGGGCACGGAAGGTGGAG
UTR dot + 25 ….(.(((((…..))))).)(((((((((((((.((…((((.(((((.(((((…….))))).)))))))))..))))))))….))))))).((((((((..((…(((((((.((((……))))..))))))))).))))))))………….
RS 1 seq UCUAGCAGAAGAGGAGCAUUGCCCAGGCAGGUUUGGUGUGGAACCCCAAUUCCAAGACACCUAACUCAGGGGGAGCAAUGCCGAGAUGACAAUUCAUUGCGGGUGAAUUGAGCAUCGGGCGAGCAGGUUGAAUCCUGCCGACUGUCACCCUAGGUGAAGAGCUUCUGAGGUA
RS 1 dot ……………(((((((((…..((((.(((((((((……))))…))))).))))…..)).)))))))..(((.(.(..((((((..((((((………(((.((.(((((……))))))).)))))))))..))))))..)).)))……
RS 2 seq UAUAGCAGAAGAGGAGCAUUGCCCAGGCAGGUUUGGUGUGGAACCCCAAUUCCAAGACACCUAACUCAGGGGGAGCAAUGCCGAGAUGACAAUUCAUUGCGGGUGAAUUGAGCAUCGGGCGAGCAGGUUGAAUCCUGCCGACUGUCACCCUAGGUGAAGAGCUUCUGAGGUA
RS 2 dot ……………(((((((((…..((((.(((((((((……))))…))))).))))…..)).)))))))..(((.(.(..((((((..((((((………(((.((.(((((……))))))).)))))))))..))))))..)).)))……
RS 3 seq AUAAUUUGUGGAAAGAAGGAUCUGACUGGUGAAAAGGGAAACAGGUGAGAAUCCUGUACGAACUCGUCACCGUGUUUUGCAAGCAGAAGCUACAGAUCCACUGGGAGAACCGGGAAGGGAGCAGAUGUGUCAGAGCAAUAAGCCGGGAGACCUGCCUUUCGCAGUACAGGAAC
RS 3 dot ……………..(((((((..((((…..(.(((((((((((((.((……))..)).))))).)))))).)……..))))))))))).((((…..))))(((((..((((..((.((.(.((…..)))..)).)))))))))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table