Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA050072 Similarity: 0.949 Similarity: 0.942 Similarity: 0.941
UTR: 5HSAA050072
Gene: HNRNPH2
MFE: -51.061
ENS: 0.899
Length: 195.
Predicted Ligands:
cobalamin - 15/20
TPP - 2/20
FMN - 1/20
 RS: URS0002317C34_230954
MFE: -52.454
Ligand: cobalamin
Species: Bacillus thermozeamaize Cobalamin riboswitch
 RS: URS0002316233_1797838
MFE: -54.772
Ligand: cobalamin
Species: Deltaproteobacteria bacterium RBG_16_47_11 Cobalamin riboswitch
 RS: URS0000C59A06_1293441
MFE: -54.613
Ligand: FMN
Species: Lysinibacillus contaminans FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA050072 URS0002317C34_230954 URS0002316233_1797838 URS0000C59A06_1293441
Length 195. 194. 194. 194.
Similarity - 0.949 0.942 0.941
Ensemble Norm 0.899 - - -
MFE -51.061 -52.454 -54.772 -54.613
Ligands - cobalamin cobalamin FMN
Gene HNRNPH2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 7.002 10.019
Length SE - 1. 1. 1.
Lev Distance - 61. 72. 72.
UBS 14. 16. 15. 14.
BS 0. 0. 0. 0.
ILL 4. 5. 4. 4.
ILR 4. 3. 3. 3.
H 3. 3. 3. 4.
BL 6. 6. 4. 4.
BR 4. 6. 5. 6.
UN 0.174 0.165 0.134 0.036

Sequences

Field Description
UTR seq + 25 cguaggcgcucacgugauuacucgcuuacgugagcagaaguaguucuggucgucgucuaccgucucgcuauagccguuugagggaagaaggaggaaaauuacccgguaucguuagagcuacaccaaaauugcauugagccaaacuugccaccaagagcccaacaaucaccATGATGCTGAGCACGGAAGGCAGGG
UTR dot + 25 …….((((((((((……..))))))))))….((((((((((….((..(((((((((.((.(..((…….))..).))))))………))))).))))))))))))………………….((((((.((….((.((.(.((((…))))).)).))..))..)))))).
RS 1 seq GAAUAGAGGAUCGGCAGAGGUGCCCGCAGGCAGUUCGAUGGGCUUAAAAGGGAAGACCGGUGAGAAUCCGGCACGGUCCCGCCACUGUGAUUGGGGAGAGAACCAUCAUGAAGCCACUGGGUUUUUCACCUGGGAAGGAAGAUGGGGAUCGAUGAACCAUGAGUCAGGAGACCUGCCUUUGCCGCGUUGGUCAA
RS 1 dot ……(((.((.(..(((.((((….)))).)))..).)))))………..(((((((((((((((…(((..(……((((.(((……..))))))))..))).))))))))).)))).))………….((((((((…((.(((.((((…)))).)))))…))))))))..
RS 2 seq AAAGAAAAGUGAUAUCCGGGUGAAGGGAACCCCGUAAUUCCCGUCUUGACGGGGAAAAUCGGGGACGGACCCGCCGCUGUAAUCGGGGACGAAACUUGCAAUAAACCACUGUCCUUCGACAAGCUCAGGAUGGGAAGGCGCAAGAAGUAGGAAGAUCCGAGAGUCAGAAAACCUGCCUGGAUAUUCUUCACGGA
RS 2 dot ……………..((((…….))))(((..(((((((((((((..(…..((((((((((………((((((((….)))…)))))……..))))))).))))..).)))))))))))).)))……(((((((.((((.((.(.(((…..)))))))))).))))).))…
RS 3 seq AUUCAUCUUCGGGGCAGGGUGAAAUUCCCUACCGGCGGUAAUAGAGUCGUAAAUUGUUUGUGUAUUUUAAAAUUACACAAACUCGAAAAUUUACAAUACUACUCUUCAGCCCGCGACCUGUGCAAUUUUUUUGCAUGGCUGACUUGGUGUGAUUCCAAGGCCGACAGUUACAGUCUGGAUGGGAGAAGAUGGAG
RS 3 dot ….(((.((((…((((…….)))).)))).)))…(((((.((((((((((((((((………)))))))))…..)))))))……)))))((((((……..((((((…..))))))))))))(((.((.(..(((((…(((((…….))).)).)))))..).)).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table